A Hybrid DNA-Templated Gold Nanocluster For Enhanced Enzymatic Reduction of Oxygen
Saumen Chakraborty,?,∥So ?a Babanova,§,∥Reginaldo C.Rocha,?Anil Desireddy,?Kateryna Artyushkova,§Amy E.Boncella,?,⊥Plamen Atanassov,*,§and Jennifer S.Martinez *,?,?
?
Center for Integrated Nanotechnologies,?Institute for Materials Science,Los Alamos National Laboratory,PO BOX 1663,Los Alamos,New Mexico 87545,United States §
Center for Micro-Engineered Materials (CMEM)and Department of Chemical &Biological Engineering,The University of New Mexico,Advanced Materials Laboratory,1001University Blvd.SE,Albuquerque,New Mexico 87106,United States
*
Supporting Information often su ?er from poor electronic communication displays phosphorescence with large Stokes shift and With sources of fossil fuels dwindling,there is an urgent need to ?nd cheap,renewable,and alternate forms of energy using naturally abundant resources such as sunlight,air,and water.Nanostructured materials and enzymatic fuel cells are showing great promise in this respect.1In enzymatic fuel cells,both the anodic and cathodic reactions are carried out by enzymes acting as bioelectrocatalysts.The enzymes oxidize fuels at the anode while reduction of O 2takes place at the cathode,typically catalyzed by multicopper oxidases (MCOs).2The e ?ciency of these systems depends on how e ?ectively the enzymes communicate with the electrode surface via direct electron transfer (DET)at potentials close to the redox potential of the enzyme.3
Although MCOs have been used as ORR catalysts on various electrode surfaces they su ?er from low conversion e ?ciency primarily due to the lack of e ?ective ET between the electrode surface and the enzyme active site.In addition,there is a need for engineering suitable material architectures that provide a large surface area for good electrical connectivity,substrate accessibility to the enzyme,and yet still retain a biocompatible environment for enzyme immobilization.Overcoming these limitations can enable widespread utilization of enzymatic fuel cells as simpli ?ed devices for single-compartment operation
neutral reaction conditions and integration into various scalable systems.To this end,gold nanoparticles (AuNPs)have been used as substrates for immobilization of laccase,which showed enhanced oxygen reduction kinetics by DET.4However,the electrochemical output of this system still remained poor.
Atomically precise metal nanoclusters (NCs)with a diameter of less than 2nm and consisting of ~2?200atoms arranged in well-de ?ned and stable geometric structures are showing important applications across multidisciplinary ?elds such as sensing,bioimaging,electronics,photovoltaics,and catalysis.5Because of their ultrasmall size,NCs possess discrete molecule-like electronic,optical,and electrochemical properties as well as speci ?c packing of atoms on NC surface and the metallic core.6These unique electronic and structural aspects of NCs play critical roles in ?ne-tuning their characteristics and bestow them with size-dependent properties that are quite di ?erent from those of bulk metals,metal complexes,and metal nanoparticles.
Although bulk gold is inert,7gold nanoparticles (AuNPs)larger than 2nm in diameter have been shown to possess
Received:May 22,2015
D o w n l o a d e d b y C A P I T A L N O R M A L U N I V o n S e p t e m b e r 14, 2015 | h t t p ://p u b s .a c s .o r g
P u b l i c a t i o n D a t e (W e b ): S e p t e m b e r 8, 2015 | d o i : 10.1021/j a c s .5b 05338
interesting catalytic properties when dispersed as ultra ?ne particles on metal oxide supports.8Among others,CO and hydrocarbon oxidation,hydrogenation,and reduction of nitrogen oxides and oxygen are the most notable examples where AuNPs have been employed as catalysts.8a ,9The high catalytic activity of small Au particles compared to bulk metal has been attributed to several factors,including high surface density of low coordination number Au atoms and less electron density in small Au particles compared to bulk metal.10Although several studies examined the e ?ect of NP size on catalytic activity,8,9c ,11it was only recently discovered that the catalytically active species in CO oxidation is a bilayer of 10-atom gold nanoclusters (AuNCs),~0.5nm in diameter.12Subsequently,several research groups reported catalytic activity of atomically monodisperse,ultrasmall AuNCs (<2nm)in solution toward oxidation of organic substrates,13hydro-genation,13a ,14electrocatalytic reduction of CO 2,15and ORR.16While the reported AuNCs showed a strong size e ?ect on ORR activity,unfortunately onset potentials (E onset )for ORR were low [e.g.,?0.1V for Au 11,?0.16V for Au 25,?0.2V for Au 55,and ?0.25V for Au 140(vs Ag/AgCl)]indicating a high overpotential for the reaction.16In addition,these experiments were exclusively performed in alkaline media.Therefore,e ?cient ORR catalysts need to be designed with low overpotential and which operate under more environmentally benign aqueous conditions.
Ligands are critical for the synthesis,stabilization and control of electronic properties of metal nanoclusters.17Over the past decade,DNA has been increasingly used as a ligand to prepare silver,18copper,19and platinum 20nanoclusters with interesting luminescent,detection,and catalytic properties.5d ,21Because DNA is a natural nanoscale material with strong a ?nity for metal cations,22DNA can template and localize metals to form and stabilize NCs.23In addition,exquisite control of NC size and the resulting electronic and optical properties has made DNA a natural ligand choice for NC synthesis and their various applications.Finally,the chemistry of DNA-templated NCs can be performed in water and neutral conditions,which is a green and desirable method for technology development as opposed to organic solvents or acidic/alkaline reaction https://www.wendangku.net/doc/6c10407018.html,ing these advantages of DNA as a ligand for NC synthesis having well-de ?ned materials architectures,and with the wide variety of catalytic applications of AuNCs,we set out to synthesize stable AuNCs using DNA as the ligand and investigate their applications as facilitators of ET in enzymatic fuel cells.While a few examples of DNA-templated gold nanoclusters have been reported,24their potential applications have been unexplored due to a lack a thorough characterization.We hypothesize that due to the small size,electrochemical activity and unique properties of the AuNCs the DNA-templated AuNC could facilitate ET to the enzyme active site where reduction of O 2takes place and thus lower the overpotential while increasing the electrocatalytic current density for ORR.
Herein we report synthesis and thorough characterization of a new DNA-templated AuNC.We demonstrate the application of this novel material in enzyme-based biofuel cells as facilitator of ET at the enzyme-electrode https://www.wendangku.net/doc/6c10407018.html,posites of the AuNC integrated with carbon nanotubes (CNTs)and bilirubin oxidase (BOD)were immobilized on electrode surfaces for ORR assays.Bilirubin oxidase from Myrothecium verrucaria was chosen as the desired MCO due to its known structure and ready commercial availability.BOD has an ET T1Cu site,and a
catalytic T2/T3Cu site where the reduction of O 2takes place.25The relatively high redox potential of BOD 26makes it advantageous for improving its performance toward electro-catalytic oxygen reduction.This unique application of the AuNC as facilitator of ET for ORR demonstrates the bene ?cial aspects of NC size e ?ects and opens up many possibilities for technology developments in the long term,including biosensors,actuators,and biological fuel cells.
■
RESULTS AND DISCUSSION
Electronic and Secondary Structural Changes during AuNC Formation.DNA-templated AuNC was synthesized according to Scheme 1(see Materials and Methods for details).To monitor electronic changes occurring during AuNC formation,UV ?vis absorption spectroscopy was employed.Incubation of DNA with Au(III)causes a red shift in the λmax of DNA from 261to 266nm (Figure 1),indicating complexation of Au(III)ions to the functional groups of DNA (likely binding to nucleobases by Lewis acid ?base interactions).Upon reduction of Au(III)and formation of nanoclusters,further spectral changes occur and the λmax subsequently blue-shifts from 266to 264nm (Figure 1),indicating di ?erent electronic transitions in the DNA when the AuNC is formed,compared to
Scheme 1.Synthetic Scheme of the AuNC
a
a
Black curves represent DNA backbone,pink lines represent DNA bases,individual yellow spheres represent Au(III),while AuNC is shown as the cluster of yellow
spheres.
Figure 1.Electronic changes occur during the AuNC formation.UV ?vis absorption spectra of solutions containing 15μM DNA (black line),15μM DNA +225μM HAuCl 4(blue line),and the as synthesized AuNC (red line)in 20mM phosphate bu ?er,1mM Mg(OAc)2,pH 7.The top inset shows the clear shifts in the λmax of DNA upon Au(III)complexation and subsequent AuNC formation.The bottom inset shows the spectrum of AuNC after subtraction of the absorption by DNA alone.
D o w n l o a d e d b y C A P I T A L N O R M A L U N I V o n S e p t e m b e r 14, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): S e p t e m b e r 8, 2015 | d o i : 10.1021/j a c s .5b 05338
the initial Au(III)-DNA complex.Similar trend in spectral shifts was observed during the formation of a DNA-templated AgNC.18a Upon subtracting the DNA contribution from the spectrum of AuNC,the presence of a broad shoulder centered ~394nm (3.15eV)was observed (Figure 1,inset).Discrete molecule-like electronic transitions in the range 330?390nm have been reported for small gold clusters (e.g.,A u 10?12S G 10?12,27A u 11C 12,28A u 13[P P h 3]4[S -(CH 2)11CH 3]2Cl 2,29Au 13[PPh 3]4[S(CH 2)11-CH 3]4,29and Au 8PAMAP 30),the spectral features of which depend on various factors such as ligand type,geometry,core size,and oxidation states of the clusters.31Therefore,it is likely that some or all of these factors contribute to the broadness of this shoulder feature in the spectra of the DNA-templated AuNC reported here.
To probe whether secondary structural changes occur in the DNA molecule during AuNC formation,we used circular dichroism spectroscopy,which is sensitive to changes in the chirality of ribose sugars.DNA alone shows two positive CD bands at 279and 219nm and two negative bands at 244and 209nm (Figure 2),respectively.Similar to the electronic
absorption spectrum,the CD spectrum also changes upon Au(III)complexation to DNA and subsequent reduction of Au(III)leading to the formation of AuNC (Figure 2),suggesting secondary structural changes in the DNA during these processes.Spectral shifts in both the absorption and CD spectra suggest changes in the electronic transitions and secondary structure of DNA upon Au(III)coordination and subsequent cluster formation process.
The AuNC Is a Small Cluster with ~7Au Atoms.Transmission electron microscopy (TEM)analysis was further performed to determine the size of AuNC.The TEM micrograph of the AuNC shows the presence of many small particles with average size of ~0.9nm in diameter (Figure 3),which is characteristic of small gold clusters.32The observed apparent polydispersity due to the presence of a few larger particles is originating from electron beam damage of the nanoclusters that causes sintering of the metal,which is a widely observed phenomenon while imaging such small particles.33The TEM image further proves that the material under study is truly nanocluster in nature and not plasmonic AuNPs (>2nm in diameter).To determine the number of Au atoms present in the AuNC we performed MALDI-MS of the DNA and the AuNC in both negative and positive ionization
modes.The observed molecular weights of the AuNC are 10400and 10524Da in negative and positive ionization modes,respectively;while those of DNA are 9054and 9196Da (Figure S1).After subtracting the corresponding DNA,the total number of Au atoms present in the AuNC was calculated to be ~7in both negative and positive ionization modes,suggesting that the AuNC is a 7-atom cluster ligated by a single DNA molecule.Although the widths of the AuNC peak in the MALDI spectra are greater than that of DNA alone,it is likely that the extent of ionization of DNA and AuNC are di ?erent,giving rise to di ?erences in the observed resolution.Addition-ally,given that even well characterized and atomically precise thiol-protected gold clusters exhibit broad MALDI spectra,the observation of such spectral broadening in the DNA-protected AuNC is not unusual.16,34The observed number of Au atoms in the AuNC is less than the initial molar ratio of 1:15(DNA:Au)as some of the added Au(III)produces plasmonic Au particles upon reduction (see Materials and Methods ).Furthermore,it is commonly found for DNA-templated nanoclusters that the metal ?ligand stoichiometry of the reaction mixture is not maintained in the ?nal product.18a ,c ,d ,35To further probe the composition of the AuNC,we performed energy dispersive X-ray spectroscopy (EDX)analysis to calculate the Au atom count (Figure S2).From intensities of the Au L α(9.712keV)and P K α(2.013keV)lines,the atomic percentages of P and Au were obtained.From this analysis the number of Au atoms present in one DNA molecule was found to be ~7(see Materials and Methods for details).While small clusters of 3?13Au atoms protected by ligands other than DNA have been reported,36a rigorous analysis of AuNC size and atom count has not been previously performed for any DNA-templated AuNC.
To ?nd out the number of gold atoms present in the AuNC,we inspected the P 2p and Au 4f X-ray photoelectron spectra (XPS).From these data the relative atomic %of P and Au are found to be 3.1and 0.74%,respectively.Analysis of the data yielded a ~7atom Au cluster (see Materials and Methods ),which is also consistent with the MALDI-MS and EDX data (vide supra)in suggesting the presence of ~7Au atoms in the
AuNC.
Figure 2.Secondary structural changes occur during the AuNC formation.CD spectra of solutions containing 100μM DNA (black line);150μM DNA +2250μM HAuCl 4(blue line);and the synthesized AuNC (red
line).
Figure 3.TEM shows small gold clusters.TEM image of the AuNC showing the presence of small clusters with average size of ~0.9nm in diameter.Scale bar:10nm.
D o w n l o a d e d b y C A P I T A L N O R M A L U N I V o n S e p t e m b e r 14, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): S e p t e m b e r 8, 2015 | d o i : 10.1021/j a c s .5b 05338
AuNC Is a Mixed-Valence Cluster.Next,we used XPS to investigate whether the clusters possessed only Au(0)or both Au(0)and Au(I)oxidation states.The Au 4f XPS spectrum of the AuNC sample (Figure 4,blue line)shows an intense and
sharp peak at ~85eV,a less intense and broader peak at ~88.5eV,and a small peak at ~91eV.The sharp peak at ~85eV corresponds to the Au 4f 7/2component and the other two peaks correspond to the Au 4f 5/2components.Deconvolution of the spectral envelope yielded individual Au species corresponding to di ?erent oxidation states.The Au 4f 7/2line consists of contributions from a Au(0)species at 84.2eV (Figure 4,black line)and a Au(I)species at 85eV (Figure 4,green line)present at a relative population of 0.27:1,respectively.These data therefore show that the DNA-templated AuNC has characteristics of nanoclusters with both Au(0)and Au(I)oxidation states (i.e.,a mixed-valence cluster).In addition to Au(I)and Au(0),a small fraction of residual Au(III)may still remain in the sample as observed from the Au 4f 7/2peak at 87.1eV (red dotted line).
Upon the basis of NMR and EXAFS data of Ag-coordinated DNA as well as Raman data on DNA-bound metal ions it is suggested that metals bind to DNA through the N7of purines and N3of pyrimidines.18a ,37Here,we examined the N 1s XPS data to gain insight into whether nitrogen atoms of DNA bases are ligating to Au in the AuNC.The N 1s XPS data show that the speciation of nitrogen has changed in the AuNC sample compared to metal-free DNA (Figure S3).Speci ?cally,the relative ratio of amine (398.8eV)and amide (400.3eV)peaks changes between the DNA and the AuNC samples.In addition,protonated nitrogen species (401.3eV)from the DNA bases changes signi ?cantly when the AuNC is formed.Measuring the pH of the DNA-only and the AuNC samples (both at pH ~7.0)ensured that deprotonation of the nitrogen was not due to a di ?erence in pH.Although the identity of speci ?c DNA bases that bind to the Au cannot be determined,these data suggest that the AuNC is preferentially formed with ligation from the nitrogens of the DNA bases,for which the chemical environment changes upon binding of gold.
The AuNC Displays Large Stokes Shift with Micro-second Lifetime.Having established the size and composition of DNA-templated AuNC,we explored whether it was luminescent.At relatively high concentrations (~1mM),the AuNC showed luminescence with an emission peak at 650nm
(Figure 5,blue line)resulting from a photoexcitation at 470nm (Figure 5,green line).The large Stokes shift of 180nm
suggests that the primary origin of this emission is phosphorescence,which was supported by lifetime measure-ments.Analysis of the luminescence decay curves showed the presence of two emission components with microsecond lifetimes [4.2μs (89%)and 0.6μs (11%);Figure S4)].Such large Stokes shifts and microsecond lifetimes have also been observed in luminescent Au(I)complexes,27a ,38as well as in ligand-protected luminescent AuNCs with glutathione (AuNC@GSH:λex =365nm,λem =610nm),27a D -penicillamine (AuNC@D-Pen:λex =400nm,λem =610nm),5a and dihydrolipoic acid (AuNC@DHLA:λex =490nm,λem =650nm).5b ,c A quantum yield of 2.6×10?3determined using [Ru(bpy)3]Cl 2(?=2.8×10?2in air-saturated aqueous solution)39suggests that the AuNC is weakly luminescent.However,the luminescence quantum yield is comparable to or,in some cases,several orders of magnitude greater than those of ligand-protected gold clusters with ligands such as glutathione (?= 3.5×10?3),5f tiopronin (?=3×10?3),40dimarcaptosuccinic acid (?=1×10?6),41and dodecanethiol (?=4.4×10?5,<3×10?7).42
It has been recently proposed that the origin of luminescence in AuNCs can be attributed to the presence of large fraction of Au(I),and that the AuNCs can be present as a mixed-valence species lying in between luminescent Au(I)complexes and nonluminescent AuNPs.43To test whether the luminescence in the DNA-templated AuNC is due to the presence of Au(I),the spectral changes were monitored upon reducing the Au(I)in the luminescent AuNC.Addition of NaBH 4(1.0equiv with respect to gold concentration)to a solution of AuNC caused a signi ?cant decrease in emission at 650nm,with ~90%loss of the initial luminescence (Figure S5).This observation suggests that the luminescence of DNA-templated AuNC is associated with the presence of Au(I).Consequently,no luminescence was observed when NaBH 4was used instead of dimethylamine borane (DMAB)as the reductant during the AuNC synthesis.This result corroborates the hypothesis that the presence of Au(I)is critical to the appearance of luminescence in the DNA-templated AuNC.
The AuNC Is Electrochemically Active.Electrochemical properties of the AuNC were assessed by cyclic voltammetry (CV)and di ?erential pulse voltammetry (DPV).Although the CV scans show two poorly de ?ned redox processes (Figure 6a,marked as *),DPV shows two resolved processes occurring at 0.155and 0.210V vs Ag/AgCl,respectively (Figure 6b).
From
Figure 4.The AuNC consists of both Au(0)and Au(I)oxidation states.Au 4f XPS spectra showing the presence of both Au(0)and Au(I).Blue line:experimental spectrum;red solid line:?tted spectrum;black line:Au 4f 7/2component of Au(0);green line:Au 4f 7/2component of Au(I);red dotted line:Au 4f 7/2component of residual Au(III);gray lines:corresponding Au 4f 5/2
components.
Figure 5.The luminescent AuNC shows large Stokes shift.Excitation spectrum (green line;λem =650nm)and emission spectrum (blue line;λex =470nm)of ~1mM AuNC in 20mM phosphate bu ?er,1mM Mg(OAc)2,pH 7.
D o w n l o a d e d b y C A P I T A L N O R M A L U N I V o n S e p t e m b e r 14, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): S e p t e m b e r 8, 2015 | d o i : 10.1021/j a c s .5b 05338
electrochemical studies of monolayer protected AuNCs of various sizes (e.g.,Au 25(SC6)18,44Au 38(SC 2H 4Ph)24,45and Au 67(SR)3546),multiple redox processes have been assigned to sequential one-electron oxidation/reduction of the various charge states of the clusters.Here,the two closely spaced potentials are likely associated with two successive one-electron oxidations at the AuNC (i.e.,two Au(0)/Au(I)processes).As with polynuclear charge-transfer molecular complexes,it is possible that the ?rst oxidation introduces an electronic perturbation (in addition to the change in overall charge)that causes the shift of the second process.47
Oxygen Reduction Activity of AuNC/BOD Compo-sites.Motivated by the electrochemical activity and small size of the AuNC,we investigated whether these unique properties can be utilized for enhanced ET between the electrode and the enzyme.BOD was used as an enzyme of choice as it is a well-known enzyme for catalyzing ORR.To test our hypothesis,the AuNC was integrated with BOD by using single-walled carbon nanotubes (SWNTs)as a support material.SWNT was dispersed via tetrabutylammonium bromide (TBAB)modi ?ed Na ?on.TBAB modi ?cation causes exchange of the proton from Na ?on sulfonic acid group and a ?ords the TBAB salt of Na ?on.48This modi ?cation results in an increase in the pore size of the Na ?on polymer allowing easy di ?usion of substrates and ions to the enzyme active site,and reduces acidity of Na ?on,thus making it a more biocompatible polymer for immobilization of the enzyme on the electrode surface.48DNA-templated AuNC was then mixed with the suspension of SWNT to allow for stacking of the DNA to the SWNT by noncovalent π?πstacking interactions.Next,1-pyrenebutanoic acid succinimidyl ester (PBSE)was added to the mixture followed by BOD and incubated overnight.While the pyrene groups of PBSE tether to the SWNT by π?πstacking interactions,the succinimidyl ester groups covalently attach to the surface amine groups of the BOD via succinimidyl ester-amine cross-linking chemistry to prepare the ?nal composite material BOD-AuNC/SWNT.A schematic of the composite preparation method is shown in Scheme 2.Control composites consisting of (i)SWNT and BOD (BOD/SWNT),(ii)SWNT,DNA alone,and BOD (BOD-DNA/SWNT),(iii)SWNT,plasmonic Au particles (side product in the AuNC synthesis)and BOD (BOD-plasmonic Au/SWNT)were prepared using similar methods as above but without the AuNC.For electrocatalytic ORR measurements the samples were drop cast on a rotating disk electrode (RDE),dried,and their oxygen reduction activity was tested using linear sweep voltammetry (LSV)with a scan rate of 10mV/s.
First,we performed electrochemical measurements of BOD-AuNC/SWNT composite under O 2depleted,and dissolved O 2conditions.Under O 2-depleted conditions (Figure S6,black line),very low current was observed due to the small amount of oxygen present in the electrolyte solution (~0.66mg/L).In the presence of dissolved atmospheric O 2(~6.91mg/L)moderate current was observed for the enzymatic ORR (Figure S6,red line).Below ~1.040V (vs RHE),the current density decreased because the reaction was limited by the availability of O 2in the electrolyte solution.
We next tested electrocatalytic activity of BOD-AuNC/SWNT and two control composites (BOD/SWNT and BOD-DNA/SWNT)in O 2-saturated bu ?er.The BOD/SWNT control composite (Figure 7,black line)showed catalytic
current with E onset of ~1.150V (vs RHE),apparent E 1/2of ~1.055V,and current density of ~257μA/cm 2[Δi measured as the di ?erence in current between E onset and the reductive current at 0.940V](Table 1).In contrast,the BOD-DNA/SWNT control composite (Figure 7,blue line)showed a cathodically shifted E onset at ~1.125V.In addition,E 1/2decreased to ~1.040V in conjunction with the
catalytic
Figure 6.The AuNC is electrochemically active.(a)CV scans at a scan rate of 50mV/s.(b)DPV scans in the anodic direction (pulse period =250ms,pulse width =25ms,amplitude =25mV,increment =2mV).The concentration of sample solutions were ~0.5mM AuNC in 50mM phosphate bu ?er,1mM Mg(OAc)2,pH 7.
Scheme https://www.wendangku.net/doc/6c10407018.html,posite Preparation for ORR Assays
a
a
AuNC:gold nanocluster,PBSE:1-pyrenebutanoic acid succinimidyl ester,BOD:bilirubin oxidase,RDE:rotating disk electrode,RE:reference electrode,CE:counter
electrode.
Figure 7.LSV of BOD-plasmonic Au/SWNT (purple line);BOD-DNA/SWNT (blue line);BOD/SWNT (black line);and BOD-AuNC/SWNT (red line)composite materials in O 2-saturated 0.1M phosphate bu ?er (pH 7.5).Traces and shaded areas represent the average and standard deviations,respectively,of the data obtained by testing three di ?erent samples,prepared and tested independently.Scan rate =10mV/s;rotation rate =1600rpm.[Note:Although potentials were measured vs Ag/AgCl,here they are converted and referred to against RHE due to its appropriateness to ORR;for the conversion,E RHE =E Ag/AgCl +0.059×pH +E 0Ag/AgCl (E 0Ag/AgCl =0.197V)].
D o w n l o a d e d b y C A P I T A L N O R M A L U N I V o n S e p t e m b e r 14, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): S e p t e m b e r 8, 2015 | d o i : 10.1021/j a c s .5b 05338
current density,which was reduced to ~197μA/cm 2from ~257μA/cm 2observed in the BOD/SWNT composite (Table 1).These results suggest that DNA can hinder the interfacial ET from the electrode to the enzyme and thus be detrimental to the ORR (supported by lower current densities with increase in DNA concentration,Figure S7).Remarkably,the presence of the AuNC caused signi ?cant changes in the ORR pro ?le displayed by the BOD-AuNC/SWNT composite (Figure 7,red line).First,E onset was anodically shifted to ~1.165from ~1.150V observed using the BOD/SWNT sample,corresponding to a positive shift of ~0.015V.Second,the electrocatalytic current density was increased to ~412μA/cm 2,an increase of ~155μA/cm 2compared to BOD/SWNT composite.Finally,the E 1/2increased to ~1.070V from that of ~1.055V observed using BOD/SWNT (Table 1).These exciting results,therefore,suggest that the presence of AuNC enhances the ORR activity of the enzyme by lowering the overpotential by a signi ?cant ~0.015V with concomitant increase in the kinetics of the reaction,which leads to higher catalytic current densities.To investigate whether such enhancement of ORR activity by the AuNC is speci ?c to nanoclusters,we performed LSV of BOD-plasmonic Au/SWNT control composite consisting of the SWNT,plasmonic Au particles (side product in the cluster synthesis),and BOD.This data (Figure 7,purple line)shows that the E onset shifts to ~1.120V as compared to ~1.165V observed in the presence of AuNC.Further,the E 1/2also signi ?cantly shifts to a lower potential of ~0.995V as compared to ~1.070V obtained with the BOD-AuNC/SWNT composite with a concomitant reduction of electrocatalytic current density at the electrode (~74μA/cm 2compared to ~412μA/cm 2observed with AuNC).These data,therefore,convincingly suggest that the enhancement of ORR (by lowering the overpotential by ~0.015V)as well as the enhancement of catalytic current densities in the presence of AuNC is unique to nanoclusters,which improved kinetics and thermodynamics of ORR.Such enhancement of ORR activity by the AuNC is unprecedented.The likely mechanism by which the AuNC enhances the ORR performance is by facilitating the ET between the electrode surface and the enzyme active site through a more e ?ective electronic communication.These ?ndings suggest that employment of the AuNC as an enhancer of ET between the electrode surface and the enzyme active site can potentially remove a signi ?cant barrier in enzymatic fuel cells,which often su ?er from poor performance due to a lack of electronic communication between the electrode and the enzyme active site.
While the E onset of the BOD-AuNC/SWNT composite is comparable (Table 1)to that of a BOD on air breathing gas di ?usion electrode (GDE)(1.160V vs RHE),the observed apparent E 1/2in the current system (Table 1)is higher than that of the GDE (0.920V vs RHE).49In addition,the BOD-AuNC/SWNT composite showed higher E onset and E 1/2compared to many reported in literature including BOD on spectrographic graphite (E onset =1.136V,E 1/2=1.036V vs RHE),50and BOD on CNTs (E onset =1.149V,E 1/2=0.950V vs RHE).51The present system also displays better thermodynamic parameters (Table 1)compared to many Pt-based materials.For example,platinum nanoparticles of various sizes (3?7nm)reduced O 2with E onset =0.870?0.920V and E 1/2=0.750V vs RHE,52platinum nanoclusters and graphene oxide composites (Pt n /gDNA-GO)showed E onset =1.010V and E 1/2=0.900V vs RHE,20b Pt and Pt/Pd nanotubes as well as graphene supported Pt and Pd catalysts and Pt/Pd nanodendrites showed ORR with E 1/2=0.850?0.900V vs RHE.53Furthermore,a recently reported Co 3O 4nanocrystals on graphene showed ORR activity with E onset =0.880V and E 1/2=0.790?0.830V vs RHE.54
Further evidence of this unique role of AuNC was obtained from ORR currents measured using a di ?erent electrode design.In this case,the electrode material (multiwalled Bucky paper (MWBP))was ?rst soaked in AuNC solution,followed by PBSE and BOD for the immobilization of the various components (see Materials and Methods for details).The modi ?ed MWBP was then placed on a glassy carbon cap electrode and the electrode performance toward ORR was monitored in O 2-saturated bu ?er by measuring potentiostatic polarization curves.The sample containing both AuNC and BOD caused an increase in the ORR current density to ~735μA/cm 2(Figure 8,red line)from that of ~493μA/cm 2
obtained using BOD alone (Figure 8,black line),amounting to an increase in current density of ~50%.Therefore,these results also demonstrate that the AuNC is enhancing the performance of BOD by acting as a facilitator of the ET between the electrode surface and the enzyme active site.Mechanistic Insight on 4e ?vs 2e ?Reduction.To understand whether the presence of the AuNC perturbs the mechanism of ORR by BODs with regards to 2e ?vs 4e ?processes,we performed mass and charge balance analysis of
Table 1.Electrochemical Results Obtained from LSVs in O 2-Saturated Bu ?er a
sample E onset V vs Ag/AgCl (V vs RHE)E 1/2V vs Ag/AgCl (V vs RHE)Δi b (μA/cm 2)BOD-plasmonic Au/SWNT 0.480(1.120)0.355(0.995)74BOD-DNA/SWNT 0.485(1.125)0.400(1.040)197BOD/SWNT 0.510(1.150)0.415(1.055)257BOD-AuNC/SWNT
0.525(1.165)
0.430(1.070)
412
a
Potentials vs RHE in parentheses.b Δi is the di ?erential current between the onset potential (E onset )and the reductive current at 0.940
V.
Figure 8.The AuNC enhances ORR by BOD.Potentiostatic polarization curves for BOD/MWBP (black line);and BOD-AuNC/MWBP (red line)carried out in 0.1M phosphate bu ?er (pH 7.5).Standard deviations were calculated from data obtained by testing three di ?erent samples,prepared and tested independently.
D o w n l o a d e d b y C A P I T A L N O R M A L U N I V o n S e p t e m b e r 14, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): S e p t e m b e r 8, 2015 | d o i : 10.1021/j a c s .5b 05338
rotating ring disk electrode (RRDE)data obtained using the BOD-AuNC/SWNT composite in O 2-saturated bu ?er (Figure S8).From this analysis the number of electrons (n )transferred during O 2reduction can be calculated using the following equation:
=
+
η*()
n 4
1i i R D
(1)
where i R is the ring current,i D is the disk current,and ηis the collection e ?ciency at the electrode.55For RRDE,the collection e ?ciency is known to be 37%.The calculated number of electrons transferred during O 2reduction by BOD-AuNC/SWNT composite was found to be 3.9±0.1.This result indicates that less than 3%of O 2was partially reduced by 2e ?to H 2O 2(O 2+2e ?+2H +→H 2O 2),while almost all of O 2was reduced to H 2O by a 4e ?reduction process (O 2+4e ?+4H +→2H 2O).These observations lead to the conclusion that the presence of the AuNC did not perturb the mechanism of O 2reduction by BOD,56and that the BOD-AuNC/SWNT composite material cleanly reduced O 2to H 2O with minimal production of reactive oxygen species (ROS).
■
CONCLUSIONS
In conclusion,a new DNA-templated AuNC has been synthesized and thoroughly characterized.While the TEM,MALDI,EDX,and XPS analyses show that the AuNC is ~1nm in diameter and consists of ~7Au atoms,XPS also suggests the presence of both Au(0)and Au(I)oxidation states.The AuNC shows weak photoluminescence with microsecond lifetime and large Stokes shift.The observed phosphorescence can be attributed to the presence of high fraction of Au(I)in the cluster.The AuNC is electrochemically active and enhances the performance of BOD catalyzed enzymatic ORR by lowering the overpotential by ~15mV,and improving the electronic communication between the electrode and the enzyme active site.RRDE analysis showed that the presence of the AuNC did not perturb the mechanism of O 2reduction,as the BOD-AuNC/SWNT composite material cleanly reduced O 2to H 2O in a 4e ?pathway.Furthermore,we show that the enhancement of ORR activity is unique to nanoclusters and not to plasmonic gold nanoparticles.This unique role as ET enhancers at the enzyme-electrode interface makes the new AuNC as a potential candidate for the development of cathodes for enzymatic fuel cells,thus lifting a critical methodological barrier in biofuel cell design.
■
MATERIALS AND METHODS
Synthesis and Puri ?cation of the AuNC.In a typical synthesis,15μM single-stranded DNA (IDT,standard desalting)of sequence ACCCGAACCTGGGCTACCACCCTTAATCCCC was mixed with 225μM HAuCl 4.3H 2O (Sigma-Aldrich,≥99.9%trace metals basis)in a solution of 20mM phosphate bu ?er (pH 7),1mM Mg(OAc)2(Fisher Scienti ?c)and equilibrated for 24h with inverted mixing at room temperature (RT,23±2°C).After equilibration,the solution became yellow.Reduction of Au(III)was initiated by addition of 2.25mM dimethylamine borane (DMAB,Sigma-Aldrich)followed by equilibration at RT for 16h.At this point,a purple solution was formed indicating the presence of plasmonic Au particles.This solution was then puri ?ed by spin ?ltration using 30kDa MWCO membranes (Millipore).A yellow solution of the AuNC was collected in the ?ltrate while the plasmonic Au particles were retained in the membrane.The AuNC solution was stored at 4°C before further use.Whenever necessary,the as-synthesized AuNC was concentrated using
10kDa MWCO membranes.The highest yield of AuNC was obtained at a maximum reaction volume of ~5mL.At higher reaction volumes the yield of the AuNC signi ?cantly decreased and plasmonic Au particles were formed at a greater extent.For energy dispersive X-ray spectroscopy (EDX)measurements (see below)and to determine the P 2p atomic %from XPS,the AuNC was synthesized in a solution of 50mM NH 4OAc bu ?er (pH 5.5),1mM Mg(OAc)2to avoid error in measuring the relative ratio of Au:P arising from the presence of P in phosphate bu ?er.
UV ?Vis and Fluorescence Spectroscopy.UV ?vis spectra were collected at RT using a Cary 5000(Agilent)UV ?vis NIR spectrophotometer.Fluorescence spectra were collected using wither a Cary Eclipse spectrophotometer or a Horiba Jobin Yvon Fluoromax 4spectro ?uorometer,with an excitation/emission band-pass of 5nm.In lifetime measurements,the spectro ?uorometer was coupled with a time-correlated single photon counting (TCSPC)system from Horiba Jobin Yvon.The apparatus was equipped with a pulsed laser diode source (NanoLED)operating at 1MHz and with excitation centered at 452nm.Analysis of ?uorescence decay pro ?les was performed with the Horiba DAS6software.All measurements were performed at RT.Quantum yield was determined by the gradient method,57using [Ru(bpy)3]Cl 2in air-saturated aqueous solution as the standard (λem =625nm;?=2.8×10?2).39The excitation wavelength (λex )was 470nm,and the absorbance of both standard and AuNC sample solutions was maintained in the 0.03?0.1range.
CD Spectroscopy.CD spectra were collected on a JASCO instrument using a 1mm path length cuvette.Three scans were collected for each sample.
TEM Imaging.Bright-?eld transmission electron microscopy (TEM)analysis of the AuNC was performed using a FEI Tecnai F30instrument operating at 200kV acceleration voltage.A thin carbon-coated (carbon ?lm thickness <10nm)copper TEM grid (Paci ?c Grid-Tech,300mesh,3.05mm O.D.,hole size:~63μm)was soaked in as-synthesized AuNC solution for 2h and air-dried before imaging.
MALDI-MS.MALDI data were collected on ABSciex 4800Plus TOF/TOF MALDI mass spectrometer using both DNA and AuNC samples in both positive and negative ion modes with sinapinic acid (Sigma-Aldrich)as matrix.The AuNC was synthesized using the same DNA stock solution,which was used for MALDI-MS analysis of the DNA-only sample.
EDX Measurements.Energy dispersive X-ray spectroscopy (EDX)data were collected at 30kV acceleration voltage using a FEI Quanta 400FEG-E-SEM instrument equipped with an EDX system (EDAX Inc.).Data processing was performed using Genesis software.A concentrated sample (~1?2mM)of the AuNC synthesized in NH 4OAc bu ?er was drop cast and dried on carbon tape.The ratio of gold to phosphorus in the DNA backbone was calculated based on the total atomic %of these two elements determined from the intensities of the Au L α(9.712keV)and P K α(2.013keV)lines in the EDX spectra of the sample.Contribution from spectral overlap of the Au M line (2.120keV)to the P K αline was subtracted.The atomic percentages of these two elements were calculated to be 14and 59.2,respectively.The total atomic percentage of phosphorus present in the DNA was then used to calculate the number of DNA molecules,determined to be 1.9(59.2/31)by taking the contributions from 31P atoms (in this study,the DNA is 31nucleotides long).As nanoclusters are formed by a single DNA molecule,the number of Au atoms present in the AuNC was found to be ~7.4±1.0(14/1.9).
XPS Measurements and Processing.Samples were drop cast on mica surface and air-dried before measurements.XPS measurements were performed with a Kratos Axis Ultra DLD X-ray photoelectron spectrometer using a monochromatic Al K αsource operating at 225W.The data were acquired from 3di ?erent areas in the sample.Survey and high resolution C 1s,O 1s,N 1s,and Au 4f were acquired at 80and 20eV pass energy,respectively.Standard operating conditions for charge compensation were:bias voltage of 3.1V,?lament voltage of ?1.0V,and ?lament current of 2.1A.Data analysis and quanti ?cation were performed using the CasaXPS software.A linear background was
D o w n l o a d e d b y C A P I T A L N O R M A L U N I V o n S e p t e m b e r 14, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): S e p t e m b e r 8, 2015 | d o i : 10.1021/j a c s .5b 05338
used for C 1s,N 1s,O 1s,and Shirley background for Au 4f spectra.All of the spectra were charge referenced to the C 1s at 284.7eV.Quanti ?cation utilized sensitivity factors that were provided by the manufacturer.A 70%Gaussian/30%Lorentzian (GL (30))line shape was used for the curve ?ttings.
Atomic %of P and Au obtained from P 2p and Au 4f XPS data were found to be 3.1%and 0.74%,respectively.Upon normalizing the atomic %of P to 1DNA molecule (which has 31nucleotides and thus 31P atoms),we obtain 0.1as the normalization factor (3.1/31=0.1).After normalizing the atomic %of Au with this normalization factor,the number of Au atoms present in the AuNC is thus calculated to be 7.4(0.74/0.1=7.4).
Electrochemistry.Cyclic voltammetry (CV)and di ?erential pulse voltammetry (DPV)experiments were performed using a CH Instruments CHI760E potentiostat.A three-electrode setup consisted of a glassy carbon working electrode (3.0mm disk),a Pt wire auxiliary electrode,and a standard Ag/AgCl reference electrode.Cyclic voltammograms were recorded at scan rates of 10?100mV s ?1and were let run for at least ten full cycles.The 20mM phosphate bu ?er solution (pH 7)containing 1mM Mg(OAc)2(used in the AuNC synthesis)was the only electrolyte source.Di ?erential pulse voltammograms were obtained at a pulse period of 250ms,pulse width of 25ms,amplitude of 25mV,and increment of 2mV.All sample solutions were ?rst deoxygenated and then blanketed with an argon atmosphere throughout the CV and DPV experiments.
Electrochemical Measurements for ORR.1.Preparation of BOD-AuNC/SWNT Composite Materials.First,a suspension of 1%single-walled carbon nanotubes (SWNT,https://www.wendangku.net/doc/6c10407018.html,)in 4:1water:methanol solution and 0.1%tetrabutylammonium bromide (TBAB)-modi ?ed Na ?on (provided by Prof.Shelley Minteer,University of Utah)in absolute ethanol was made and bath sonicated for 30min at RT to disperse the SWNT.Five μL of the AuNC solution was added to 40μL of the SWNT-TBAB-Na ?on suspension and left for 1h to allow for the stacking of the DNA to the SWNT.Identical luminescence emission spectra of the AuNC before and after mixing with SWNT-TBAB-Na ?on con ?rmed that the integrity of the AuNC remained intact after stacking with SWNT (Figure S9).Next,2μL (4mg/mL)1-pyrenebutanoic acid succinimidyl ester (PBSE,Sigma-Aldrich)dissolved in ethanol were introduced to the SWNT-TBAB-Na ?on-AuNC mixture and incubated for additional 1h.After the PBSE adsorption on the SWNT,2μL of a 200mg/mL BOD (Amano Enzyme Inc.)solution in 100mM phosphate bu ?er at pH 7.5was added and the sample was incubated for 16?18h at 4°C.The BOD-AuNC/SWNT composite material thus prepared was further used for the ORR experiments.Controls consisting of BOD/SWNT,BOD-DNA/SWNT,and BOD-plasmonic Au/SWNT were prepared using same procedure.The concentration of DNA in the composites was estimated according to suitable dilutions from the DNA concentration in the respective precursor materials,as determined using an extinction coe ?cient of 2.78×105M ?1cm ?1provided by IDT.
A glassy carbon rotating disk electrode (RDE)(disk area 0.2475cm 2,Pine Instruments)was used.The RDE was cleaned with alumina of increasingly ?ne grits of 1,0.3,and 0.05mm,and rinsed with deionized water.After cleaning the electrode,10μL of SWNT-TBAB-Na ?on suspension were dropped on the electrode surface and dried under a ?ow of N 2gas.Next,10μL of the composite material (BOD/SWNT,BOD-DNA/SWNT,BOD-plasmonic Au/SWNT or BOD-AuNC/SWNT)was drop cast on the RDE and allowed to air-dry before the electrochemical measurements.
2.Preparation of MWBP Electrode.Circular pieces (0.3mm diameter)of MWBP were cut,immersed in a solution of the AuNC,and left for 1h for attachment of the AuNC with MWBP.The paper discs were then washed with DI water and transferred to a 10mM solution of PBSE in ethanol.After 1h,the modi ?ed nanotube paper was washed with DI water and placed in solution of BOD (10mg/mL in 100mM phosphate bu ?er,pH 7.5)and incubated at 4°C for 18h.After enzyme immobilization,the electrodes were washed again with bu ?er to remove any unattached enzyme.The modi ?ed MWBP discs were then placed on a glassy carbon cap electrode and tested in 100
mM phosphate bu ?er,pH 7.5.A control electrode was prepared the same way except for the use of AuNC.
3.Electrocatalytic Measurements.RDE measurements were performed with a WEB30Pine bipotentiostat and a rotator from Pine Instruments.A three-electrode setup (glassy carbon working electrode,Pt wire auxiliary electrode,Ag/AgCl reference electrode)was used.The electrolyte was a 100mM phosphate bu ?er solution at pH 7.5.Enough time (20min)was allowed for the system at open circuit conditions to reach https://www.wendangku.net/doc/6c10407018.html,ing linear sweep voltammetry (LSV)the disk potential was swept from 0.8to 0V at a scan rate of 10mV/s.At least three sets of independent ORR data were collected from three di ?erent preparations of composite samples as well as controls.With each preparation,the ORR currents were measured in electrolyte solutions containing dissolved O 2,saturated O 2(purged for 20min),and depleted O 2(N 2purged for 20min).Potentiostatic polarization curves of the BOD-AuNC/MWBP and BOD/MWBP electrodes were carried out by applying a constant potential for 300s,starting from open-circuit potential to 0V vs Ag/AgCl,with a step increase of 0.05V.Potentials measured against Ag/AgCl (E 0Ag/AgCl =0.197V)were converted to RHE using 58
=+×+E E E 0.059pH RHE Ag/AgCl 0Ag/AgCl
4.Oxygen Reduction Reaction Current.The electrochemical current (Δi )was calculated by determining the di ?erence in the reductive current at ~0.300V vs Ag/AgCl (0.940V vs RHE)and the current at the onset potential for oxygen reduction.
5.Mass and Charge Balance Analysis Using RRDE.For the mass and charge balance analysis using rotating ring disk electrode (RRDE),the BOD-AuNC/SWNT composite was drop cast on electrode surface,dried,and the ORR activity was measured in 100mM phosphate bu ?er at pH https://www.wendangku.net/doc/6c10407018.html,ing a bipotentiostat (Pine Instruments),the disk current was swept from 0.800to 0V at a scan rate of 10mV/s while the ring was polarized at 0.800V.Data analysis was performed according to eq 1.
■ASSOCIATED CONTENT
*
Supporting Information The Supporting Information is available free of charge on the ACS Publications website at DOI:10.1021/jacs.5b05338.
MALDI-MS,EDX,N 1s XPS,lifetime measurements,e ?ect of NaBH 4on luminescence,e ?ect of DNA concentration on electrocatalytic current density,RRDE data,and the e ?ect of SNWT on the luminescence of AuNC.(PDF )
■
AUTHOR INFORMATION
Corresponding Authors
*plamen@https://www.wendangku.net/doc/6c10407018.html, *jenm@https://www.wendangku.net/doc/6c10407018.html,
Present Address
⊥Department of Chemistry,Colorado State University,Fort Collins,Colorado 80523,United States.Author Contributions ∥
S.C.and S.B.contributed equally.
Notes
The authors declare no competing ?nancial interest.
■
ACKNOWLEDGMENTS
The authors would like to acknowledge ?nancial support by the Laboratory Directed Research and Development (LDRD)program for EDX and TEM (A.D.),synthesis,photophysics,and electrochemistry by the Basic Energy Sciences,Biomo-lecular Materials Program,Division of Materials Science &Engineering (S.C.,R.C.R.,J.S.M.).P.A.thanks the Air Force
D o w n l o a d e d b y C A P I T A L N O R M A L U N I V o n S e p t e m b e r 14, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): S e p t e m b e r 8, 2015 | d o i : 10.1021/j a c s .5b 05338
O ?ce of Scienti ?c Research (Grant FA9550-12-1-0112)and ARO-Multi-University Research Initiative grant W911NF-14-1-0263to University of Utah for funding this collaborative project.This work was performed,in part,at the Center for Integrated Nanotechnologies,an O ?ce of Science User Facility operated for the U.S.Department of Energy (DOE)O ?ce of Science.Los Alamos National Laboratory,an a ?rmative action equal opportunity employer,is operated by Los Alamos National Security,LLC,for the National Nuclear Security Administration of the U.S.Department of Energy under contract DE-AC52-06NA25396.The authors thank Dr.Darrick Williams for helping with EDX data collection,and Timothy Sanchez for helping with MALDI data collection.
■
REFERENCES
(1)(a)Qiao,Y.;Li,C.M.J.Mater.Chem.2011,21,4027?4036.(b)Zhou,M.;Wang,J.Electroanalysis 2012,24,197?209.(c)Zebda,A.;Gondran,C.;Le Goff,A.;Holzinger,M.;Cinquin,P.;Cosnier,https://www.wendangku.net/doc/6c10407018.html,mun.2011,2,370.(d)Holzinger,M.;Le Goff,A.;Cosnier,S.Electrochim.Acta 2012,82,179?190.(e)Katz,E.;MacVittie,K.Energy Environ.Sci.2013,6,2791?2803.(f)Hala m kova ,L.;Hala m ek,J.;Bocharova,V.;Szczupak,A.;Alfonta,L.;Katz,E.J.Am.Chem.Soc.2012,134,5040?5043.(g)Zafar,M.N.;Beden,N.;Leech,D.;Sygmund,C.;Ludwig,R.;Gorton,L.Anal.Bioanal.Chem.2012,402,2069?2077.(h)Harreither,W.;Felice,A.K.;Paukner,R.;Gorton,L.;Ludwig,R.;Sygmund,C.Biotechnol.J.2012,7,1359?1366.(i)Jia,W.;Valde s -Ramírez,G.;Bandodkar,A.J.;Windmiller,J.R.;Wang,J.Angew.Chem.,Int.Ed.2013,52,7233?7236.(j)Chen,X.;Li,C.;Gra t zel,M.;Kostecki,R.;Mao,S.S.Chem.Soc.Rev.2012,41,7909?7937.
(2)(a)Davis,F.;Higson,S.P.Biosens.Bioelectron.2007,22,1224?1235.(b)Minteer,S.D.;Liaw,B.Y.;Cooney,M.J.Curr.Opin.Biotechnol.2007,18,228?234.(c)Bullen,R.A.;Arnot,T.;Lakeman,J.;Walsh,F.Biosens.Bioelectron.2006,21,2015?2045.
(3)Arico , A.S.;Bruce,P.;Scrosati, B.;Tarascon,J.-M.;Van Schalkwijk,W.Nat.Mater.2005,4,366?377.
(4)Holland,J.T.;Lau,C.;Brozik,S.;Atanassov,P.;Banta,S.J.Am.Chem.Soc.2011,133,19262?19265.
(5)(a)Shang,L.;Dong,S.;Nienhaus,G.U.Nano Today 2011,6,401?418.(b)Lin,C.-A.J.;Lee,C.-H.;Hsieh,J.-T.;Wang,H.-H.;Li,J.K.;Shen,J.-L.;Chan,W.-H.;Yeh,H.-I.;Chang,W.H.J.Med.Biol.Eng.2009,29,276?283.(c)Lin,C.-A.J.;Yang,T.-Y.;Lee,C.-H.;Huang,S.H.;Sperling,R.A.;Zanella,M.;Li,J.K.;Shen,J.-L.;Wang,H.-H.;Yeh,H.-I.;Parak,W.J.;Chang,W.H.ACS Nano 2009,3,395?401.(d)Li,G.;Jin,R.Acc.Chem.Res.2013,46,1749?1758.(e)Wilcoxon,J.;Abrams,B.Chem.Soc.Rev.2006,35,1162?1194.(f)Link,S.;Beeby,A.;FitzGerald,S.;El-Sayed,M.A.;Schaaff,T.G.;Whetten,R.L.J.Phys.Chem.B 2002,106,3410?3415.(g)Proch,S.;Wirth,M.;White,H.S.;Anderson,S.L.J.Am.Chem.Soc.2013,135,3073?3086.(6)(a)Murray,R.W.Chem.Rev.2008,108,2688?2720.(b)Walter,M.;Akola,J.;Lopez-Acevedo,O.;Jadzinsky,P. D.;Calero,G.;Ackerson,C.J.;Whetten,R.L.;Gro n beck,H.;Ha k kinen,H.Proc.Natl.Acad.Sci.U.S.A.2008,105,9157?9162.(c)Jadzinsky,P.D.;Calero,G.;Ackerson,C.J.;Bushnell,D.A.;Kornberg,R.D.Science 2007,318,430?433.(d)Zeng,C.;Qian,H.;Li,T.;Li,G.;Rosi,N.L.;Yoon,B.;Barnett,R.N.;Whetten,R.L.;Landman,U.;Jin,R.Angew.Chem.2012,124,13291?13295.(e)Lee,D.;Donkers,R.L.;Wang,G.;Harper,A.S.;Murray,R.W.J.Am.Chem.Soc.2004,126,6193?6199.
(7)Hammer,B.;Norskov,J.Nature 1995,376,238?240.
(8)(a)Haruta,M.;Date ,M.Appl.Catal.,A 2001,222,427?437.(b)Haruta,M.Catal.Today 1997,36,153?166.
(9)(a)Boccuzzi,F.;Cerrato,G.;Pinna,F.;Strukul,G.J.Phys.Chem.B 1998,102,5733?5736.(b)Hayden,B.E.;Pletcher,D.;Suchsland,J.P.Angew.Chem.,Int.Ed.2007,46,3530?3532.(c)Valden,M.;Lai,X.;Goodman,D.W.Science 1998,281,1647?1650.(d)Herna n dez,J.;Solla-Gullo n ,J.;Herrero,E.;Aldaz,A.;Feliu,J.M.J.Phys.Chem.C
2007,111,14078?14083.(e)Mohr,C.;Hofmeister,H.;Radnik,J.;
Claus,P.J.Am.Chem.Soc.2003,125,1905?1911.(f)Hughes,M.D.;Xu,Y.-J.;Jenkins,P.;McMorn,P.;Landon,P.;Enache,D.I.;Carley,A.F.;Attard,G.A.;Hutchings,G.J.;King,F.;Stitt,E.H.;Johnston,P.;Griffin,K.;Kiely,C.J.Nature 2005,437,1132?1135.
(10)van Bokhoven,J.A.;Miller,J.T.J.Phys.Chem.C 2007,111,9245?9249.
(11)Tang,W.;Lin,H.;Kleiman-Shwarsctein,A.;Stucky,G.D.;McFarland,E.W.J.Phys.Chem.C 2008,112,10515?10519.
(12)Herzing,A.A.;Kiely,C.J.;Carley,A.F.;Landon,P.;Hutchings,G.J.Science 2008,321,1331?1335.
(13)(a)Zhu,Y.;Qian,H.;Zhu,M.;Jin,R.Adv.Mater.2010,22,1915?1920.(b)Liu,Y.;Tsunoyama,H.;Akita,T.;Xie,S.;Tsukuda,T.ACS Catal.2010,1,2?6.(c)Xie,S.;Tsunoyama,H.;Kurashige,W.;Negishi,Y.;Tsukuda,T.ACS Catal.2012,2,1519?1523.
(14)Zhu,Y.;Qian,H.;Drake,B.A.;Jin,R.Angew.Chem.,Int.Ed.2010,49,1295?1298.
(15)Kauffman,D.R.;Alfonso,D.;Matranga,C.;Qian,H.;Jin,R.J.Am.Chem.Soc.2012,134,10237?10243.
(16)Chen,W.;Chen,S.Angew.Chem.,Int.Ed.2009,48,4386?4389.(17)(a)Wu,Z.;Jin,R.Nano Lett.2010,10,2568?2573.(b)Xie,J.;Zheng,Y.;Ying,J.Y.J.Am.Chem.Soc.2009,31,888?889.
(18)(a)Petty,J.T.;Zheng,J.;Hud,N.V.;Dickson,R.M.J.Am.Chem.Soc.2004,126,5207?5212.(b)Zheng,J.;Nicovich,P.R.;Dickson,R.M.Annu.Rev.Phys.Chem.2007,58,409?431.(c)O ’Neill,P.R.;Velazquez,L.R.;Dunn,D.G.;Gwinn,E.G.;Fygenson,D.K.J.Phys.Chem.C 2009,113,4229?4233.(d)Schultz,D.;Gwinn,https://www.wendangku.net/doc/6c10407018.html,mun.2012,48,5748?5750.(e)Sharma,J.;Rocha,R.C.;Phipps,M.L.;Yeh,H.C.;Balatsky,K.A.;Vu,D.M.;Shreve,A.P.;Werner,J.H.;Martinez,J.S.Nanoscale 2012,4,4107?4110.(f)Sharma,J.;Yeh,H.-C.;Yoo,H.;Werner,J.H.;Martinez,https://www.wendangku.net/doc/6c10407018.html,mun.2010,46,3280?3282.(g)Yeh,H.C.;Sharma,J.;Han,J.J.;Martinez,J.S.;Werner,J.H.Nano Lett.2010,10,3106?3110.
(19)Jia,X.;Li,J.;Han,L.;Ren,J.;Yang,X.;Wang,E.ACS Nano 2012,6,3311?3317.
(20)(a)Seidel,R.;Colombi Ciacchi,L.;Weigel,M.;Pompe,W.;Mertig,M.J.Phys.Chem.B 2004,108,10801?10811.(b)Tiwari,J.N.;Nath,K.;Kumar,S.;Tiwari,R.N.;Kemp,K.C.;Le,N.H.;Youn,D.H.;Lee,J.S.;Kim,https://www.wendangku.net/doc/6c10407018.html,mun.2013,4,2221.
(21)Zhu,Y.;Qian,H.;Jin,R.J.Mater.Chem.2011,21,6793.(22)(a)Pinheiro,A.V.;Han,D.;Shih,W.M.;Yan,H.Nat.Nanotechnol.2011,6,763?772.(b)Seeman,N.C.Mol.Biotechnol.2007,37,246?257.
(23)Mertig,M.;Colombi Ciacchi,L.;Seidel,R.;Pompe,W.;De Vita,A.Nano Lett.2002,2,841?844.
(24)(a)Kennedy,T.A.;MacLean,J.L.;Liu,https://www.wendangku.net/doc/6c10407018.html,mun.2012,48,6845?6847.(b)Liu,G.;Shao,Y.;Ma,K.;Cui,Q.;Wu,F.;Xu,S.Gold Bull.2012,45,69?74.(c)Liu,G.;Shao,Y.;Wu,F.;Xu,S.;Peng,J.;Liu,L.Nanotechnology 2013,24,015503.
(25)(a)Solomon,E.I.;Heppner,D.E.;Johnston,E.M.;Ginsbach,J.W.;Cirera,J.;Qayyum,M.;Kieber-Emmons,M.T.;Kjaergaard,C.H.;Hadt,R.G.;Tian,L.Chem.Rev.2014,114,3659?3853.(b)Liu,J.;Chakraborty,S.;Hosseinzadeh,P.;Yu,Y.;Tian,S.;Petrik,I.;Bhagi,A.;Lu,Y.Chem.Rev.2014,114,4366?4469.
(26)Ivnitski,D.M.;Khripin,C.;Luckarift,H.R.;Johnson,G.R.;Atanassov,P.Electrochim.Acta 2010,55,7385?7393.
(27)(a)Luo,Z.;Yuan,X.;Yu,Y.;Zhang,Q.;Leong,D.T.;Lee,J.Y.;Xie,J.J.Am.Chem.Soc.2012,134,16662?16670.(b)Negishi,Y.;Nobusada,K.;Tsukuda,T.J.Am.Chem.Soc.2005,127,5261?5270.(28)Yang,Y.;Chen,S.Nano Lett.2003,3,75?79.
(29)(a)Menard,L.D.;Xu,H.;Gao,S.-P.;Twesten,R.D.;Harper,A.S.;Song,Y.;Wang,G.;Douglas,A.D.;Yang,J.C.;Frenkel,A.I.J.Phys.Chem.B 2006,110,14564?14573.(b)Menard,L.D.;Gao,S.-P.;Xu,H.;Twesten,R.D.;Harper,A.S.;Song,Y.;Wang,G.;Douglas,A.D.;Yang,J.C.;Frenkel,A.I.J.Phys.Chem.B 2006,110,12874?12883.
(30)Zheng,J.;Petty,J.T.;Dickson,R.M.J.Am.Chem.Soc.2003,125,7780?7781.
D o w n l o a d e d b y C A P I T A L N O R M A L U N I V o n S e p t e m b e r 14, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): S e p t e m b e r 8, 2015 | d o i : 10.1021/j a c s .5b 05338
(31)(a)Jaw,H.R.C.;Mason,W.R.Inorg.Chem.1991,30,275?278.(b)Hall,K.P.;Theoblad,B.R.C.;Gilmour,D.I.;Mingos,D.M.P.;Welch, A.J.J.Chem.Soc.,https://www.wendangku.net/doc/6c10407018.html,mun.1982,528?530.(c)Bartlett,P.A.;Bauer,B.;Singer,S.J.Am.Chem.Soc.1978,100,5085?5089.
(32)Zheng,J.;Zhang,C.;Dickson,R.M.Phys.Rev.Lett.2004,93,077402.
(33)(a)Ramasamy,P.;Guha,S.;Shibu,E.S.;Sreeprasad,T.S.;Bag,S.;Banerjee,A.;Pradeep,T.J.Mater.Chem.2009,19,8456?8462.(b)Levi-Kalisman,Y.;Jadzinsky,P.D.;Kalisman,N.;Tsunoyama,H.;Tsukuda,T.;Bushnell,D.A.;Kornberg,R.D.J.Am.Chem.Soc.2011,133,2976?2982.
(34)Qian,H.;Jin,R.Chem.Mater.2011,23,2209?2217.
(35)Petty,J.T.;Fan,C.;Story,S.P.;Sengupta,B.;Iyer,A.S.;Prudowsky,Z.;Dickson,R.M.J.Phys.Chem.Lett.2010,1,2524?2529.
(36)(a)Santiago Gonzalez,B.;Rodriguez,M.J.;Blanco,C.;Rivas,J.;Lopez-Quintela,M.A.;Gaspar Martinho,J.M.Nano Lett.2010,10,4217?4221.(b)Guliamov,O.;Frenkel,A.I.;Menard,L.D.;Nuzzo,R.G.;Kronik,L.J.Am.Chem.Soc.2007,129,10978?10979.
(37)(a)Sengupta,B.;Ritchie,C.M.;Buckman,J.G.;Johnsen,K.R.;Goodwin,P.M.;Petty,J.T.J.Phys.Chem.C 2008,112,18776?18782.(b)Ritchie,C.M.;Johnsen,K.R.;Kiser,J.R.;Antoku,Y.;Dickson,R.M.;Petty,J.T.J.Phys.Chem.C 2007,111,175?181.(c)Neidig,M.L.;Sharma,J.;Yeh,H.-C.;Martinez,J.S.;Conradson,S.D.;Shreve,A.P.J.Am.Chem.Soc.2011,133,11837?11839.(d)Duguid,J.;Bloomfield,V.A.;Benevides,J.;Thomas,G.J.,Jr Biophys.J.1993,65,1916.
(38)(a)Yam,V.W.W.;Cheng,E.C.C.;Zhou,Z.Y.Angew.Chem.,Int.Ed.2000,39,1683?1685.(b)White-Morris,R.L.;Olmstead,M.M.;Jiang,F.;Tinti,D.S.;Balch,A.L.J.Am.Chem.Soc.2002,124,2327?2336.(c)Cha,S.-H.;Kim,J.-U.;Kim,K.-H.;Lee,J.-C.Chem.Mater.2007,19,6297?6303.
(39)Brouwer,A.M.Pure Appl.Chem.2011,83,2213?2228.
(40)Huang,T.;Murray,R.W.J.Phys.Chem.B 2001,105,12498?12502.
(41)Negishi,Y.;Tsukuda,T.Chem.Phys.Lett.2004,383,161?165.(42)Bigioni,T.;Whetten,R.;Dag,O .J.Phys.Chem.B 2000,104,6983?6986.
(43)Chen,S.;Wang,S.;Zhong,J.;Song,Y.;Zhang,J.;Sheng,H.;Pei,Y.;Zhu,M.Angew.Chem.,Int.Ed.2015,54,3145?3149.
(44)Garcia-Raya,D.;Madueno,R.;Blazquez,M.;Pineda,T.J.Phys.Chem.C 2009,113,8756?8761.
(45)Qian,H.;Zhu,Y.;Jin,R.ACS Nano 2009,3,3795?3803.(46)Nimmala,P.R.;Yoon,B.;Whetten,R.L.;Landman,U.;Dass,A.J.Phys.Chem.A 2013,117,504?517.
(47)Zanello,P.Inorganic Electrochemistry:Theory,Practice,and Application ;Royal Society of Chemistry,Cambridge,U.K.,2003.(48)Moore,C.M.;Akers,N.L.;Hill,A.D.;Johnson,Z.C.;Minteer,S.D.Biomacromolecules 2004,5,1241?1247.
(49)Gupta,G.;Lau,C.;Rajendran,V.;Colon,F.;Branch,B.;Ivnitski,D.;Atanassov,https://www.wendangku.net/doc/6c10407018.html,mun.2011,13,247?249.(50)Shleev,S.;El Kasmi,A.;Ruzgas,T.;Gorton,https://www.wendangku.net/doc/6c10407018.html,mun.2004,6,934?939.
(51)(a)Ramasamy,R.P.;Luckarift,H.R.;Ivnitski, D.M.;Atanassov,P.B.;Johnson,https://www.wendangku.net/doc/6c10407018.html,mun.2010,46,6045?6047.(b)Weigel,M.C.;Tritscher,E.;Lisdat,https://www.wendangku.net/doc/6c10407018.html,mun.2007,9,689?693.
(52)Wang,C.;Daimon,H.;Onodera,T.;Koda,T.;Sun,S.Angew.Chem.,Int.Ed.2008,47,3588?3591.
(53)(a)Chen,Z.;Waje,M.;Li,W.;Yan,Y.Angew.Chem.,Int.Ed.2007,46,4060?4063.(b)Seo,M.H.;Choi,S.M.;Kim,H.J.;Kim,https://www.wendangku.net/doc/6c10407018.html,mun.2011,13,182?185.(c)Lim,B.;Jiang,M.;Camargo,P.H.;Cho,E.C.;Tao,J.;Lu,X.;Zhu,Y.;Xia,Y.Science 2009,324,1302?1305.
(54)Liang,Y.;Li,Y.;Wang,H.;Zhou,J.;Wang,J.;Regier,T.;Dai,H.Nat.Mater.2011,10,780?786.
(55)(a)Hsueh,K.L.;Chin,D.T.;Srinivasan,S.J.Electroanal.Chem.Interfacial Electrochem.1983,153,79?95.(b)Brett,C.M.A.;Brett,A.
M.O.Electrochemistry Principles,Methods and Applications ;Oxford University Press,Inc.:New York,NY,1993.
(56)Brocato,S.;Lau,C.;Atanassov,P.Electrochim.Acta 2012,61,44?49.
(57)Williams,A.T.R.;Winfield,S.A.;Miller,J.N.Analyst 1983,108,1067?1071.
(58)Bard, A.J.;Faulkner,L.R.Electrochemical Methods:Fundamentals and Applications ;Wiley:New York,1980;Vol.2.
D o w n l o a d e d b y C A P I T A L N O R M A L U N I V o n S e p t e m b e r 14, 2015 | h t t p ://p u b s .a c s .o r g P u b l i c a t i o n D a t e (W e b ): S e p t e m b e r 8, 2015 | d o i : 10.1021/j a c s .5b 05338