Molecular Cell

Short Article LincRNA-p21Suppresses Target mRNA Translation

Je-Hyun Yoon,1Kotb Abdelmohsen,1Subramanya Srikantan,1Xiaoling Yang,1Jennifer L.Martindale,1Supriyo De,2 Maite Huarte,3Ming Zhan,4Kevin G.Becker,2and Myriam Gorospe1,*

1Laboratory of Molecular Biology and Immunology

2Research Resources Branch

National Institute on Aging–Intramural Research Program,National Institutes of Health,Baltimore,MD21224,USA

3Department of Oncology,CIMA,University of Navarra,31008Pamplona,Spain

4Department of Systems Medicine and Bioengineering,The Methodist Hospital Research Institute,Houston,TX77030,USA

*Correspondence:myriam-gorospe@https://www.wendangku.net/doc/929382289.html,

https://www.wendangku.net/doc/929382289.html,/10.1016/j.molcel.2012.06.027

SUMMARY

Mammalian long intergenic noncoding RNAs (lincRNAs)are best known for modulating transcrip-tion.Here we report a posttranscriptional function for lincRNA-p21as a modulator of translation. Association of the RNA-binding protein HuR with lincRNA-p21favored the recruitment of let-7/Ago2 to lincRNA-p21,leading to lower lincRNA-p21 stability.Under reduced HuR levels,lincRNA-p21 accumulated in human cervical carcinoma HeLa cells,increasing its association with JUNB and

CTNNB1mRNAs and selectively lowering their translation.With elevated HuR,lincRNA-p21levels declined,which in turn derepressed JunB and

b-catenin translation and increased the levels of these proteins.We propose that HuR controls translation of a subset of target mRNAs by in?u-encing lincRNA-p21levels.Our?ndings uncover a role for lincRNA as a posttranscriptional inhibitor of translation.

INTRODUCTION

Gene expression is robustly regulated at the posttranscriptional level by RNA-binding proteins(RBPs)and by noncoding RNAs (ncRNAs).Small ncRNAs,particularly microRNAs(miRNAs), partially base pair with speci?c target mRNAs and repress their expression by lowering mRNA stability and/or translation (Chekulaeva and Filipowicz,2009;Guo et al.,2010).Gene repression by miRNAs is accomplished through the recruitment of RNA-induced silencing complex(RISC)components such as argonaute2(Ago2),which cleaves target mRNA,and Rck/ p54,which facilitates the formation of cytoplasmic processing bodies(PBs),remodels mRNA-associated ribonucleoprotein complexes(mRNPs),and in?uences mRNA translation,storage, and degradation(Weston and Sommerville,2006;Chu and Rana,2006;Bartel,2009).Long ncRNAs(lncRNAs)have been implicated in numerous gene transcription processes,as indicators of transcription factor activity,decoys that titrate away RBPs,functional guides for RNP complexes,and scaffolds for the assembly of functionally related proteins like transcrip-tional regulators(Wang and Chang,2011).LncRNAs have also been reported to participate in a limited number of post-transcriptional processes:the lncRNA metastasis-associated lung adenocarcinoma transcript1(MALAT1)was implicated in splicing,the cytoplasmic half-Staufen1-binding site lncRNAs (1/2-sbsRNAs)was implicated in Staufen1-mediated mRNA decay,and an antisense lncRNA(BACE1-AS)interacts with and stabilizes the mRNA encoding the enzyme BACE1(Faghihi et al.,2008;Tripathi et al.,2010;Gong and Maquat,2011). Recently,photoactivatable ribonucleoside-enhanced cross-linking and immunoprecipitation(PAR-CLIP)analysis(Mukherjee et al.,2011)revealed that the RBP HuR associates with many mRNAs in human cervical carcinoma HeLa cells($75%of PAR-CLIP RNA tags),and with numerous ncRNAs($25%of tags,identi?ed as described by Cabili et al.,2011).Among these,the vast majority were lncRNAs,including lincRNA-p21, MALAT1,NEAT1,and lncRNAs involved in X chromosome inactivation(Cabili et al.,2011;Mukherjee et al.,2011).HuR is a ubiquitous RBP that in?uences cell proliferation,survival, carcinogenesis,and the stress and immune responses.HuR performs these functions mainly by associating with subsets of mRNAs and increasing their stability and/or modulating their translation(Hinman and Lou,2008;Abdelmohsen and Gorospe, 2010).For a few HuR target mRNAs,HuR affects mRNA stability and translation by competing or cooperating with mRNA decay-promoting RBPs(e.g.,AUF1,TTP[Lal et al.,2004;Young et al., 2009])and with miRNAs(e.g.,miR-122,let-7[Bhattacharyya et al.,2006;Kim et al.,2009]).However,for most target mRNAs, the molecular effectors of HuR’s posttranscriptional in?uence are unknown.

RESULTS AND DISCUSSION

HuR Associates with lincRNA-p21,Recruits let-7/RISC, Accelerates lincRNA-p21Degradation

An association between HuR with lincRNA-p21was detected using the RNP immunoprecipitation(RIP)assay(Experimental Procedures).IP reactions were carried out using HeLa cell lysates and anti-HuR antibody,and RNA was extracted from the IP material and analyzed by RT-qPCR using primers speci?c to human lincRNA-p21,a transcript expressed from a locus between CDKN1A and SFSR3(see Figure S1A available online). The human lincRNA-p21was readily detectable in HeLa cells and was$3.0kb in length,like the mouse counterpart(Figures

648Molecular Cell47,648–655,August24,2012a2012Elsevier Inc.

S1A–S1C).We sought to investigate this interaction further, given the role of HuR and lincRNA-p21in the stress response (Abdelmohsen and Gorospe,2010;Huarte et al.,2010).As shown,lincRNA-p21was strongly enriched in anti-HuR IP reactions and in control anti-hnRNP K IP reactions(Huarte et al.,2010),but not in anti-AUF1IP reactions(Figure1A). HuR-lincRNA-p21interactions were also detected in mouse cells(Figures S1D and S1E).

We hypothesized that HuR might stabilize lincRNA-p21,as HuR stabilizes many mRNAs(Hinman and Lou,2008).Forty-eight hours after silencing HuR using small interfering RNA (siRNA)in HeLa cells,we measured the steady-state lincRNA-p21levels,as well as the lincRNA-p21half-life after inhibiting transcription by incubating cells with actinomycin D and measuring the rate of lincRNA-p21clearance using RT-qPCR. Contrary to prediction,lincRNA-p21levels were higher and its half-life longer in HuR-silenced cells(t1/2$3hr)than in control cells(t1/2$1.2hr)(Figure1B),indicating that HuR destabilized

the lincRNA-p21.Accordingly,lincRNA-p21expression levels were signi?cantly higher in mouse embryonic?broblasts (MEFs)derived from a mouse lacking both HuR alleles(HuRà/à; Figure S2A)(Katsanou et al.,2009).These results indicate that HuR enhances lincRNA-p21decay.

Given earlier evidence that HuR suppressed target c-Myc mRNA expression by facilitating its interaction with let-7/RISC (Kim et al.,2009),we examined whether a similar repression mechanism controlled lincRNA-p21levels.Mouse lincRNA-p21 was predicted to associate with several miRNAs,with let-7 showing a prominent effect among them(Figures S2B and S2C).These interactions appeared to be functional,as MEFs de?cient in Ago2,a necessary component of let-7/RISC (Chelou?et al.,2010),displayed higher lincRNA-p21levels (Figure S2D).In HeLa cells,Ago2RIP analysis showed robust enrichment in lincRNA-p21(Figure1C),while transfection of biotinylated precursor let-7b(pre-let-7b)followed by pull-down analysis of bound endogenous target mRNAs using streptavidin beads and RT-qPCR analysis(Lal et al.,2011)revealed a marked enrichment in lincRNA-p21compared with a control transcript (GAPDH mRNA),but not in pull-downs using nonbiotinylated control pre-let-7b(Figure1D).These interactions affected lincRNA-p21stability,as its half-life was higher after Ago2 silencing(t1/2$3hr)and was lower after overexpressing pre-let-7b(t1/2$0.9hr)(Figure1E).Collectively,these data indicate that HuR and let-7/Ago2lower lincRNA-p21stability.

As assessed by RIP analysis,silencing Ago2in HeLa cells reduced the interaction of HuR with lincRNA-p21,while silencing HuR lowered the interaction of Ago2with lincRNA-p21(Figures 1F and1G).Overexpression of Flag-tagged HuR signi?cantly reduced lincRNA-p21levels but did not reverse the elevated lincRNA-p21levels observed after inhibition of endogenous let-7using an antagomir(AS-let-7b)(Figure1H).Together with evidence that the heightened lincRNA-p21after HuR silencing was prevented by overexpressing pre-let-7(Figure1I),and that mutating let-7sites can block the HuR-elicited repression (Figure S1C),our?ndings suggest that HuR and let-7/Ago2 repress lincRNA-p21expression cooperatively,and that HuR and let-7/Ago2binding to lincRNA-p21is crucial for lincRNA-p21decay.LincRNA-p21Selectively Interacts with Target CTNNB1 and JUNB mRNAs

LincRNA-p21was moderately more abundant in the cytoplasm than in the nucleus of fractionated HeLa cells,and its levels increased proportionately after silencing HuR(Figure2A). LincRNA-p21subcellular localization was further analyzed by tagging lincRNA-p21with MS2RNA hairpins,tracked intra-cellularly by?uorescent fusion protein MS2-YFP(Bertrand et al.,1998;Lee et al.,2010;Figure S3A).We postulated that this distribution could impact upon cytoplasmic gene regulatory events and further hypothesized that lincRNA-p21might elicit some of HuR’s effects on target mRNAs.

To test these possibilities,we focused on mRNAs encoding b-catenin(CTNNB1)and JunB(JUNB),identi?ed as being trans-lationally repressed after HuR was silenced(Lo′pez de Silanes et al.,2003;Lebedeva et al.,2011).Several regions of high complementarity with lincRNA-p21were identi?ed for CTNNB1 mRNA(15sites)and for JUNB mRNA(8sites),but only2for GAPDH mRNA(Figure2B;Table S1).In HeLa cells,the inter-action of endogenous lincRNA-p21with CTNNB1and JUNB mRNAs was quanti?ed by af?nity pull-down of endogenous lincRNA-p21using a biotinylated RNA antisense to lincRNA-p21(Experimental Procedures).As shown in Figure2C,CTNNB1 and JUNB mRNAs showed signi?cantly greater interaction with lincRNA-p21than GAPDH mRNA(used for normalization of sample input)and18S rRNA(used as reference for enrich-ment).Similarly,biotinylated mouse lincRNA-p21incubated with MEF lysates,followed by RNA extraction and detection by RT-qPCR,revealed its selective interaction with mouse ctnnb1and junb mRNAs(Figures S3B and S3C);conversely, in vitro-transcribed unlabeled lincRNA-p21was selectively pulled down using biotinylated mouse ctnnb1and junb RNAs (Figure S3D).

Lowering HuR in HeLa cells decreased b-catenin and JunB levels,as assessed by western blotting(Figure2D).Strikingly, however,simultaneous silencing of lincRNA-p21by using a speci?c siRNA that lowered lincRNA-p21levels to$40%–45% of the levels seen in Ctrl siRNA cells(Figure2E)and preferentially silenced cytoplasmic lincRNA-p21(Figure S3F)prevented the decline in b-catenin and JunB levels(Figure2D).Simply silencing lincRNA-p21or Ago2in HeLa cells did not affect b-catenin or JunB levels(Figure S3G),supporting the notion that repression required HuR silencing.These effects were not due to changes in CTNNB1or JUNB mRNA levels(Figure2F),nor were they due to changes in b-catenin or JunB protein stability(data not shown),suggesting that lincRNA-p21likely reduced the transla-tion of CTNNB1and JUNB mRNAs.

LincRNA-p21Associates with Translational Apparatus, Diminishes CTNNB1and JUNB Polysomes

To directly test the possibility that lincRNA-p21may in?uence translation,HeLa cell lysates expressing different lincRNA-p21 and HuR levels were fractionated through sucrose gradients. The lightest components sedimented at the top(fractions1 and2),small(40S),and large(60S)ribosomal subunits and monosomes(80S)in fractions three to?ve,and progressively larger polysomes,ranging from low to high molecular weight (LMW,HMW),in fractions six to ten(Figure3A).Silencing HuR

Molecular Cell

lincRNA-p21Represses Translation

Molecular Cell47,648–655,August24,2012a2012Elsevier Inc.649

Figure 1.HuR and let-7/Ago Cooperatively Promote lincRNA-p21Decay

(A)RIP analysis of HeLa cell lysates using IgG and antibodies recognizing HuR,AUF1,or hnRNP K.LincRNA-p21and housekeeping GAPDH mRNA abundance was quanti?ed using RT-qPCR and represented as enrichment in RBP RIP compared with IgG RIP.

(B)Forty-eight hours after transfecting HeLa cells with Ctrl or HuR siRNAs,HuR and loading control HSP90levels were assessed by WB (top left),the steady-state lincRNA-p21and GAPDH mRNA levels quanti?ed by RT-qPCR (bottom left),and the half-life of lincRNA-p21was quanti?ed by measuring the decline in transcript levels after actinomycin D treatment.

(C)RIP analysis of the interaction of Ago2with lincRNA-p21,performed as in (A).

(D)Forty-eight hours after transfection of HeLa cells with pre-let-7or biotin-pre-let-7,the relative enrichment of endogenous lincRNA-p21was assessed by biotin pull-down.

(E)Forty-eight hours after silencing Ago2or overexpressing pre-let-7b in HeLa cells,the steady-state levels and half-life of lincRNA-p21were assessed as in (B).

(F and G)Forty-eight hours after transfecting HeLa cells with HuR siRNA (F)or Ago2siRNA (G),the association of lincRNA-p21with Ago2(F)and HuR (G)was assessed by RIP analysis.

(H and I)Forty-eight hours after overexpressing Flag-HuR (H)in HeLa cells,silencing HuR (I),expressing let-7b antagomir (AS-let-7b)(H),or overexpressing let-7b (I),lincRNA-p21abundance was assessed by RT-qPCR analysis.

In all panels,the data represent the means and SD (error bars)from three independent experiments.Western blots in (B),(E),and (H)are representative of three independent experiments.

Molecular Cell

lincRNA-p21Represses Translation

650Molecular Cell 47,648–655,August 24,2012a2012Elsevier Inc.

and/or lincRNA-p21did not change the polysome distribution pro?les or eIF2a phosphorylation (Figure 3A,Figure S4A),indi-cating that these interventions did not affect global translation.After isolating RNA from each fraction,RT-qPCR analysis indicated that lincRNA-p21was abundant in fractions six to nine;although silencing HuR elevated lincRNA-p21levels over-all,its distribution shifted toward smaller polysomes (Figure 3B,top left).LincRNA-p21associated with polysomes and did not simply cosediment with polysomes,as puromycin treatment,which disrupts polysomes,markedly shifted leftward the distri-bution of lincRNA-p21(Figure 3B,top right).The polysomal sizes of CTNNB1and JUNB mRNAs also shifted leftward after

HuR

Figure 2.lincRNA-p21Associates with CTNNB1and JUNB mRNAs,Lowers Their Expression

(A)Forty-eight hours after transfecting siRNAs in HeLa cells,the levels of nuclear control transcript (U6),cytoplasmic control transcript (GAPDH mRNA),and lincRNA-p21were assessed by RT-qPCR in nuclear and cytoplasmic fractions (left),and WB analysis was performed (right).

(B)Regions of predicted interaction between lincRNA-p21and human CTNNB1and JUNB mRNAs;details in Table S1.

(C)HeLa cell lysates were incubated with 50end biotin-labeled antisense lincRNA-p21oligo (lincRNA-p21pull-down)and sense oligo (control pull-down);after pull-down,RNA was extracted and CTNNB1and JUNB mRNAs,as well as normalization control 18S rRNA,were assessed by RT-qPCR.

(D and E)Forty-eight hours after transfecting HeLa cells with siRNAs,the levels of b -catenin,JunB,HuR,and HSP90were assessed by WB analysis and densitometry (D),and lincRNA-p21(E),CTNNB1,and JUNB mRNAs (F)were quanti-?ed by RT-qPCR.

In (A)and (C)–(F),data represent the means and SD (error bars)from at least three independent experiments.Western blots in (A)and (D)are representative of three independent experiments.

silencing,in keeping with reduced trans-lation (Figure 3B,bottom).Interestingly,silencing lincRNA-p21totally prevented the reduction in polysomes seen after silencing HuR (Figure 3B,bottom),in agreement with the increased b -catenin and JunB abundance (Figure 2E).The distribution of the housekeeping GAPDH mRNA did not show this pattern (Fig-ure 3B,bottom),indicating that silencing HuR siRNA and/or lincRNA-p21speci?-cally affected CTNNB1and JUNB mRNAs.It remains to be determined whether other mRNAs are translationally repressed by lincRNA-p21in this manner,as well as the fractions of JUNB and CTNNB1mRNA pools that associate with lincRNA-p21.

Finally,we investigated if lincRNA-p21inhibited the translation of CTNNB1and JUNB mRNAs by enhancing their interaction with translational repressors.By RIP analysis,the translational repressors Rck and FMRP were found to interact with lincRNA-p21in HeLa cells (Figure 4A)and MEFs (Figure S4B ).In HeLa lysates,Rck and FMRP (but not TIAR)also associated with MS2-tagged lincRNA-p21(immobilized on beads via MS2-GST;Figure S4C).Interestingly,the interaction of endoge-nous lincRNA-p21with endogenous CTNNB1and JUNB mRNAs in HeLa cells (measured as in Figure 2C)was potently reduced if Rck was silenced (Figure 4B),indicating that Rck facilitated these interactions.A similar effect of Rck was seen with a tagged

Molecular Cell

lincRNA-p21Represses Translation

Molecular Cell 47,648–655,August 24,2012a2012Elsevier Inc.651

mouse lincRNA-p21(Figure S4D).Conversely,when lincRNA-p21was silenced,Rck did not associate with CTNNB1or JUNB mRNAs (Figure 4C).In turn,silencing Rck in HeLa cells reversed the inhibition of b -catenin and JunB expression seen after HuR silencing (Figure 4D,top);lincRNA-p21levels were not markedly changed by Rck silencing (Figure 4D,graph).These ?ndings indicated that the repression of b -catenin and JunB translation by lincRNA-p21required Rck function (Chu and Rana,2006).Supporting this possibility,the decline in the sizes of polysomes associated with CTNNB1and JUNB mRNAs

after silencing HuR (previously attributed to the higher lincRNA-p21levels [Figure 3B])was only seen when Rck was expressed (Figures 4E and 4F);lincRNA-p21followed a similar distribution pattern (Figure S4E).Whether Rck reduces the translation of other mRNAs in a similar fashion remains to be studied.Perspective:lincRNA-p21Inhibits Translation of Target mRNAs

Based on these results,we propose that in the presence of HuR,lincRNA-p21is unstable through the recruitment of

let-7/Ago2.

Figure 3.lincRNA-p21Associates with Polysomes,Suppresses b -Catenin and JunB Translation

Forty-eight hours after siRNA transfection of HeLa cells,(A)polysomes in cytoplasmic extracts were fractionated through sucrose gradients (arrow,direction of sedimentation;–,no ribosomal components),and (B)the relative distribution of lincRNA-p21on polysome gradients ±puromycin (top),and relative levels of CTNNB1,JUNB ,and GAPDH mRNAs (bottom),were studied by RT-qPCR analysis of RNA in gradient fractions,and represented as percentage of total RNA in the gradient.Data are representative of three independent experiments.

Molecular Cell

lincRNA-p21Represses Translation

652Molecular Cell 47,648–655,August 24,2012a2012Elsevier Inc.

Figure 4.Translation Inhibition by lincRNA-p21Involves Recruitment of Translation Repressor Rck

All experiments were done in HeLa cells.

(A)RIP analysis of the interaction of endogenous lincRNA-p21with Rck and FMRP.

Molecular Cell

lincRNA-p21Represses Translation

Molecular Cell 47,648–655,August 24,2012a2012Elsevier Inc.653

HuR then promotes the translation of targets CTNNB1and JUNB

mRNAs by favoring their association with polysomes (Lo

′pez de Silanes et al.,2003;Lebedeva et al.,2011)(Figure 4G).In the absence of HuR,lincRNA-p21is stable and accumulates,and Rck promotes the association of lincRNA-p21with CTNNB1and JUNB mRNAs,repressing their translation through a mechanism that includes reduced polysome sizes (Figure 4G);in addition,base-pair interactions of lincRNA-p21with target mRNAs may result in ribosome ‘‘drop-off.’’In sum,HuR-dependent translation activation requires rapid degradation of lincRNA-p21in order to prevent the recruitment of translation repressors onto target mRNAs.Similar regulation may affect other mRNAs whose trans-lation increases by HuR (Abdelmohsen and Gorospe,2010).Through these regulatory processes,HuR can help implement a well-established pro-oncogenic,cell-protective program (Figures S4F and S4G)which includes prosurvival proteins b -catenin and JunB (Shaulian,2010;Fu et al.,2011).With rising recognition that lncRNAs play pivotal roles in disease processes (Wapinski and Chang,2011),other proteins regulated by the orchestrated in?uence of RBPs,lncRNAs,and miRNAs are likely to emerge.

EXPERIMENTAL PROCEDURES

Cell Culture,Transfection,Small Interfering RNAs,MicroRNAs,and Plasmids

Human HeLa cells and MEFs were cultured in DMEM (Invitrogen)supple-mented with 10%(v/v)FBS and antibiotics.All siRNAs,including control (Ctrl)siRNA (UUCUCCGAACGUGUCACGUdTdT),and siRNAs to lower lincRNA-p21(CTGCAAGGCCGCATGATGAdTdT),HuR (CGUAAGUUAUUU CCUUUAAdTdT),Ago2,and Rck (sc-44409and sc-72246,respectively,Santa Cruz Biotechnology),were transfected at 20nM ?nal concentration using Lipofectamine 2000(Invitrogen)and analyzed 48hr later.Pre-and AS-let-7b (Ambion)were transfected at 10nM ?nal concentration.The oligomers for af?nity pull-down of endogenous human lincRNA-p21(GGGTGGCTCACT CTTCTGGC [antisense]and GCCAGAAGAGTGAGCCACCC [sense])were biotinylated at the 50end.Actinomycin D (Sigma)was used at 2.5m g/m l.A plasmid expressing lincRNA-p21(Huarte et al.,2010),was used to construct plasmid plincRNA-p21-MS2.Plasmid pMS2-YFP was previously reported (Lee et al.,2010);pMS2-GST was a kind gift from J.A.Steitz.

Western Blot Analysis

Whole-cell lysates,prepared in RIPA buffer,were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE),and transferred onto PVDF membranes (Invitrogen iBlot Stack).Primary antibodies recognizing b -catenin,JunB,a -tubulin,histone H1,HSP90,HuR,Rck,FMRP,GFP,eIF2a ,and phospho-eIF2a were from Santa Cruz Biotechnology.Antibodies recognizing Ago2,MBP,AUF1,TIAR,and Flag were from Abcam,Cell Signaling Tech-nology,Millipore,BD Biosciences,and Sigma,respectively.HRP-conjugated secondary antibodies were from GE Healthcare.

Immunoprecipitation Assays

For immunoprecipitation (IP)of endogenous RNP complexes from whole-cell extracts (Abdelmohsen et al.,2007),cells were lysed in 20mM Tris-HCl at pH

7.5,100mM KCl,5mM MgCl 2,and 0.5%NP-40for 10min on ice and centrifuged at 10,0003g for 15min at 4 C.The supernatants were incubated with protein A Sepharose beads coated with antibodies that recognized HuR,Rck,or FMRP (Santa Cruz Biotechnology),Ago2(Abcam),or AUF1(Millipore),or with control IgG (Santa Cruz Biotechnology)for 1hr at 4 C.After the beads were washed with NT2buffer (50mM Tris-HCl [pH 7.5],150mM NaCl,1mM MgCl 2,and 0.05%NP-40),the complexes were incubated with 20units of RNase-free DNase I (15min at 37 C)and further incubated with 0.1%SDS/0.5mg/ml Proteinase K (15min at 55 C)to remove DNA and proteins,respectively.The RNPs isolated from the IP materials was further assessed by RT-qPCR analysis.

RNA Analysis

Trizol (Invitrogen)was used to extract total RNA and acidic phenol (Ambion)was used to extract RNA for RIP analysis (Abdelmohsen et al.,2007).Reverse transcription (RT)was performed using random hexamers and reverse tran-scriptase (SSII,Invitrogen)and real-time,quantitative PCR (qPCR)using gene-speci?c primers (Table S2)and SYBR green master mix (Kapa Biosys-tems),using the Applied Biosystems 7300instrument.

Biotin Pull-Down Assay

To synthesize biotinylated transcripts,PCR fragments were prepared using forward primers that contained the T7RNA polymerase promoter sequence (Abdelmohsen et al.,2007).Primers used to prepare biotinylated transcripts are listed below (Table S2).After puri?cation of the PCR products,biotinylated transcripts were synthesized using MaxiScript T7kit (Ambion)and whole-cell lysates (50m g per sample)were incubated with 1m g of puri?ed biotinylated transcripts for 1hr at 25 C;complexes were isolated with streptavidin-coupled Dynabeads (Invitrogen).The proteins present in the pull-down material were detected by western blot analysis and the RNA present in the pull-down material by RT-qPCR analysis.

Biotinylated lincRNA-p21was synthesized using T7RNA polymerase and plasmid pcDNA3lincRNA-p21(Huarte et al.,2010).Forward PCR primers contained the T7RNA polymerase promoter sequence (CCAAGCTTCTAA TACGACTCACTATAGGGAGA [T7]).Primers used are listed in Table S2.

For antisense oligomer pull-down,biotin-labeled DNA complementary to human lincRNA-p21(0.5m g)was incubated with HeLa cell lysates for 2hr,and the complexes were isolated with streptavidin-coupled Dynabeads (Invitrogen).Polysome Analysis

Forty-eight hours after transfection with siRNAs,HeLa cells were preincubated with cycloheximide (Sigma;100m g/ml for 15min),and cytoplasmic lysates were prepared and fractionated by ultracentrifugation through 15%–60%linear sucrose gradients;ten fractions were collected,and RNA extracted from each fraction was used for RT-qPCR analysis,as described (Lee et al.,2010).Subcellular Fractionation

Cytosolic and nuclear fractions were collected as described previously (Lal et al.,2004).Brie?y,cells were lysed with a buffer containing 10mM Tris-HCl (pH 7.4),100mM,NaCl,2.5mM MgCl 2,and 40m g/ml digitonin for 10min,and the resulting lysates were centrifuged with 2,0603g for 10min at 4 C.The supernatant was used for the cytosolic fraction.The pellets were washed,incubated with RIPA buffer at 4 C for 10min and the nuclear fraction collected after centrifugation at 4 C for 10min at 21,0003g .

(B)Forty-eight hours after transfecting the siRNAs shown,the relative interaction of lincRNA-p21and CTNNB1or JUNB mRNAs was studied by RIP analysis.(C)RIP analysis of Rck interaction with CTNNB1or JUNB mRNAs in cells expressing normal levels or silenced lincRNA-p21.

(D)WB analysis and densitometric quanti?cation (top)and lincRNA-p21RT-qPCR analysis (bottom)48hr after silencing Rck and/or HuR.

(E and F)Forty-eight hours after transfecting the siRNAs shown,polysomes were prepared (E),and the relative distribution of CTNNB1,JUNB ,and GAPDH mRNAs (F)was studied as explained in Figure 3.

(G)Schematic of the proposed mechanism whereby lincRNA-p21,under negative control by HuR,represses the translation of CTNNB1and JUNB mRNAs;see text for details.

Data in (A)–(D)represent the means and SD (error bars)from three independent experiments.Data in (B)and (D)–(F)are representative of three independent experiments.

Molecular Cell

lincRNA-p21Represses Translation

654Molecular Cell 47,648–655,August 24,2012a2012Elsevier Inc.

Bioinformatic Analysis of lincRNA-p21Interaction Sites with mRNAs We used BLAST(https://www.wendangku.net/doc/929382289.html,/)to identify local regions of sequence similarity between lincRNA-p21(Supplemental Information)and CTNNB1mRNA(NM_001904.3),JUNB mRNA(NM_002229.2),and GAPDH mRNA(NM_002046.3).The similarity regions with a length R20bp,E value %210and matching to the reverse complementary sequence of lincRNA-p21were selected as and considered as possible interaction regions through base-paring between lincRNA-p21and each mRNA.Table S1lists the putative interaction regions identi?ed.

SUPPLEMENTAL INFORMATION

Supplemental Information includes supplemental text,four?gures,and two tables and can be found with this article at https://www.wendangku.net/doc/929382289.html,/10.1016/j.molcel. 2012.06.027.

ACKNOWLEDGMENTS

We thank D.L.Kontoyiannis,G.J.Hannon,N.Mukherjee,and J.D.Keene for providing reagents and information.J.-H.Y.,K.A.,S.S.,X.Y.,J.L.M.,S.D., K.G.B.,and M.G.were supported by the NIA-IRP,NIH.M.Z.was supported by NIH U54CA149169.

Received:February6,2012

Revised:May24,2012

Accepted:June18,2012

Published online:July26,2012

REFERENCES

Abdelmohsen,K.,and Gorospe,M.(2010).Posttranscriptional regulation of cancer traits by HuR.Wiley Interdiscip.Rev.RNA1,214–229. Abdelmohsen,K.,Pullmann,R.,Jr.,Lal,A.,Kim,H.H.,Galban,S.,Yang,X., Blethrow,J.D.,Walker,M.,Shubert,J.,Gillespie, D.A.,et al.(2007). Phosphorylation of HuR by Chk2regulates SIRT1expression.Mol.Cell25, 543–557.

Bartel,D.P.(2009).MicroRNAs:target recognition and regulatory functions. Cell136,215–233.

Bertrand,E.,Chartrand,P.,Schaefer,M.,Shenoy,S.M.,Singer,R.H.,and Long,R.M.(1998).Localization of ASH1mRNA particles in living yeast.Mol. Cell2,437–445.

Bhattacharyya,S.N.,Habermacher,R.,Martine,U.,Closs,E.I.,and Filipowicz, W.(2006).Relief of microRNA-mediated translational repression in human cells subjected to stress.Cell125,1111–1124.

Cabili,M.N.,Trapnell,C.,Goff,L.,Koziol,M.,Tazon-Vega,B.,Regev,A.,and Rinn,J.L.(2011).Integrative annotation of human large intergenic noncoding RNAs reveals global properties and speci?c subclasses.Genes Dev.25, 1915–1927.

Chekulaeva,M.,and Filipowicz,W.(2009).Mechanisms of miRNA-mediated post-transcriptional regulation in animal cells.Curr.Opin.Cell Biol.21, 452–460.

Chelou?,S.,Dos Santos,C.O.,Chong,M.M.,and Hannon,G.J.(2010).A dicer-independent miRNA biogenesis pathway that requires Ago catalysis. Nature465,584–589.

Chu,C.Y.,and Rana,T.M.(2006).Translation repression in human cells by microRNA-induced gene silencing requires RCK/p54.PLoS Biol.4,e210. Faghihi,M.A.,Modarresi,F.,Khalil,A.M.,Wood,D.E.,Sahagan,B.G.,Morgan, T.E.,Finch,C.E.,https://www.wendangku.net/doc/929382289.html,urent,G.,3rd,Kenny,P.J.,and Wahlestedt,C.(2008). Expression of a noncoding RNA is elevated in Alzheimer’s disease and drives rapid feed-forward regulation of beta-secretase.Nat.Med.14,723–730. Fu,Y.,Zheng,S.,An,N.,Athanasopoulos,T.,Popplewell,L.,Liang,A.,Li,K., Hu,C.,and Zhu,Y.(2011).b-catenin as a potential key target for tumor suppression.Int.J.Cancer129,1541–1551.Gong,C.,and Maquat,L.E.(2011).lncRNAs transactivate STAU1-mediated mRNA decay by duplexing with30UTRs via Alu elements.Nature470, 284–288.

Guo,H.,Ingolia,N.T.,Weissman,J.S.,and Bartel,D.P.(2010).Mammalian microRNAs predominantly act to decrease target mRNA levels.Nature466, 835–840.

Hinman,M.N.,and Lou,H.(2008).Diverse molecular functions of Hu proteins. Cell.Mol.Life Sci.65,3168–3181.

Huarte,M.,Guttman,M.,Feldser,D.,Garber,M.,Koziol,M.J.,Kenzelmann-Broz,D.,Khalil,A.M.,Zuk,O.,Amit,I.,Rabani,M.,et al.(2010).A large inter-genic noncoding RNA induced by p53mediates global gene repression in the p53response.Cell142,409–419.

Katsanou,V.,Milatos,S.,Yiakouvaki,A.,Sgantzis,N.,Kotsoni,A.,Alexiou,M., Harokopos,V.,Aidinis,V.,Hemberger,M.,and Kontoyiannis,D.L.(2009).The RNA-binding protein Elavl1/HuR is essential for placental branching morpho-genesis and embryonic development.Mol.Cell.Biol.29,2762–2776.

Kim,H.H.,Kuwano,Y.,Srikantan,S.,Lee,E.K.,Martindale,J.L.,and Gorospe, M.(2009).HuR recruits let-7/RISC to repress c-Myc expression.Genes Dev. 23,1743–1748.

Lal, A.,Mazan-Mamczarz,K.,Kawai,T.,Yang,X.,Martindale,J.L.,and Gorospe,M.(2004).Concurrent versus individual binding of HuR and AUF1 to common labile target mRNAs.EMBO J.23,3092–3102.

Lal, A.,Thomas,M.P.,Altschuler,G.,Navarro, F.,O’Day, E.,Li,X.L., Concepcion,C.,Han,Y.C.,Thiery,J.,Rajani,D.K.,et al.(2011).Capture of microRNA-bound mRNAs identi?es the tumor suppressor miR-34a as a regulator of growth factor signaling.PLoS Genet.7,e1002363.http://dx.doi. org/10.1371/journal.pgen.1002363.

Lebedeva,S.,Jens,M.,Theil,K.,Schwanha¨usser,B.,Selbach,M.,Landthaler, M.,and Rajewsky,N.(2011).Transcriptome-wide analysis of regulatory inter-actions of the RNA-binding protein HuR.Mol.Cell43,340–352.

Lee,E.K.,Kim,H.H.,Kuwano,Y.,Abdelmohsen,K.,Srikantan,S.,Subaran, S.S.,Gleichmann,M.,Mughal,M.R.,Martindale,J.L.,Yang,X.,et al.(2010). hnRNP C promotes APP translation by competing with FMRP for APP mRNA recruitment to P bodies.Nat.Struct.Mol.Biol.17,732–739.

Lo′pez de Silanes,I.,Fan,J.,Yang,X.,Zonderman,A.B.,Potapova,O.,Pizer, E.S.,and Gorospe,M.(2003).Role of the RNA-binding protein HuR in colon carcinogenesis.Oncogene22,7146–7154.

Mukherjee,N.,Corcoran,D.L.,Nusbaum,J.D.,Reid,D.W.,Georgiev,S., Hafner,M.,Ascano,M.,Jr.,Tuschl,T.,Ohler,U.,and Keene,J.D.(2011). Integrative regulatory mapping indicates that the RNA-binding protein HuR couples pre-mRNA processing and mRNA stability.Mol.Cell43,327–339.

Shaulian,E.(2010).AP-1–The Jun proteins:oncogenes or tumor suppressors in disguise?Cell.Signal.22,894–899.

Tripathi,V.,Ellis,J.D.,Shen,Z.,Song,D.Y.,Pan,Q.,Watt,A.T.,Freier,S.M., Bennett,C.F.,Sharma,A.,Bubulya,P.A.,et al.(2010).The nuclear-retained noncoding RNA MALAT1regulates alternative splicing by modulating SR splicing factor phosphorylation.Mol.Cell39,925–938.

Wang,K.C.,and Chang,H.Y.(2011).Molecular mechanisms of long noncod-ing RNAs.Mol.Cell43,904–914.

Wapinski,O.,and Chang,H.Y.(2011).Long noncoding RNAs and human disease.Trends Cell Biol.21,354–361.

Weston,A.,and Sommerville,J.(2006).Xp54and related(DDX6-like)RNA hel-icases:roles in messenger RNP assembly,translation regulation and RNA degradation.Nucleic Acids Res.34,3082–3094.

Young,L.E.,Sanduja,S.,Bemis-Standoli,K.,Pena,E.A.,Price,R.L.,and Dixon, D.A.(2009).The mRNA binding proteins HuR and tristetraprolin regulate cyclooxygenase2expression during colon carcinogenesis.Gastroenterology 136,1669–1679.

Molecular Cell

lincRNA-p21Represses Translation

Molecular Cell47,648–655,August24,2012a2012Elsevier Inc.655

HTML标签以及各个标签属性大全(网页制作必备).

取消换行和
相反 总类（所有HTML文件都有的） -------------------------------------------------------------------------------- 文件类型（放在档案的开头与结尾） 文件主题（必须放在「文头」区块内） 文头（描述性资料，像是「主题」） 文体（文件本体） 结构性定义（由浏览器控制的显示风格） -------------------------------------------------------------------------------- 标题（？表示从1到6，有六层选择）数值越高字越小 标题对齐左对齐、居中对齐、右对齐 区分