race试剂盒说明书

SMART? RACE cDNA Amplification Kit User Manual

Cat. No. 634914

PT3269-1 (PR752279)

SMART? RACE cDNA Amplification Kit User Manual

T able of Contents

I. Introduction & Protocol Overview 4 II. List of Components 9 III. Additional Materials Required 10 IV. General Considerations for SMART RACE Amplification 11 V. Primer Design 12 VI. Preparation & Handling of T otal and Poly A+ RNA 15 VII. First-Strand cDNA Synthesis 16 V III. Positive Control PCR Experiment 18 IX. Rapid Amplification of cDNA Ends (RACE) 21 X. Characterization of RACE Products 24 XI. T roubleshooting Guide 27 XII. References 35 X III. Related Products 36 Appendix A: Detailed Flow Chart of 5'-RACE 37 Appendix B: Detailed Flow Chart of 3'-RACE 38 Appendix C: Suppression PCR and Step-Out PCR 39

SMART? RACE cDNA Amplification Kit User Manual T able of Contents continued

List of Figures

Figure 1. Mechanism of SMART cDNA synthesis 4 Figure 2. Overview of the SMART RACE procedure 6 Figure 3. The relationship of gene-specific primers to the cDNA

template 13 Figure 4. 5'- and 3'-RACE sample results 20 Figure 5. Detailed mechanism of the 5'-RACE reactions 37 Figure 6. Detailed mechanism of the 3'-RACE reactions 38 Figure 7. Mechanisms of suppression PCR and step-out PCR 40

List of T ables

Table I: Additional 5'-RACE sequence obtained with

SMART technology 5 Table II: Setting up the positive control RACE experiment 19 Table III: Setting up 5'-RACE PCR reactions 21 Table IV: Setting up 3'-RACE PCR reactions 22

SMART? RACE cDNA Amplification Kit User Manual

I. Introduction & Protocol Overview

The SMART? RACE cDNA Amplification Kit provides a method for performing both 5'- and 3'-rapid amplification of cDNA ends (RACE). T his kit integrates

our Marathon ? cDNA Amplification Kit (Chenchik et al., 1995; 1996) with our

SMART (Switching Mechanism At 5' end of RNA T ranscript) cDNA synthesis technology. This powerful combination allows you to isolate the complete 5' sequence of your target transcript more consistently than ever before. Furthermore, SMART technology eliminates the need for problematic adaptor ligation and lets you use first-strand cDNA directly in RACE PCR, a benefit that makes RACE far less complex and much faster (Chenchik et al., 1998). The SMART RACE Kit also includes advances in PCR technology that both increase the sensitivity and reduce the background of the RACE reactions. As a result you can use either poly A + or total RNA as starting material for constructing full-length cDNAs of even very rare transcripts.

SMART technology provides a mechanism for generating full-length cDNAs in reverse transcription reactions (Zhu et al., 2001). This is made possible by the joint action of the SMART II? A Oligonucleotide and the Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV RT). The MMLV RT , upon reaching the end of an RNA template, exhibits terminal transferase activity, adding 3–5 residues (predominantly dC) to the 3' end of the first-strand cDNA (Figure 1). The SMART oligo contains a terminal stretch of G residues that anneal to the dC-rich cDNA tail and serves as an extended template for RT . MMLV RT switches templates from the mRNA molecule to the SMART oligo, generating a complete cDNA copy of the original RNA with the additional SMART sequence at the end. Since the dC-tailing activ-ity of RT is most efficient if the enzyme has reached the end of the RNA template, the SMART sequence is typically added only to complete first-strand cDNAs. T his process guarantees that the use of high quality RNA will result in the formation of a set of cDNAs that have a maximum amount of 5' sequence (Table I).

Please see Addendum PT3980-4 for details on the choice of RT enzyme.

Figure 1. Mechanism of SMART? cDNA synthesis. First-strand synthesis is primed using a modified oligo (dT) primer. A fter reverse transcrip-tase reaches the end of the mRNA template, it adds several dC residues. The SMART II A Oligonucle-otide anneals to the tail of the cDNA and serves as an extended template for MML V RT .5'First-strand synthesis coupled with (dC) tailing by RT

Poly A + RNA

polyA 3'

SMART II TM A Oligonucleotide

Template switching and extension by RT

5'

G G G 5'

G G G

5'

C C

SMART? RACE cDNA Amplification Kit User Manual I. Introduction & Protocol Overview continued

Following reverse transcription, the first-strand cDNA is used directly in 5'- and 3'-RACE PCR reactions, without the need for tedious second-strand synthesis and adaptor ligation. The incorporation of SMART technology also permits the use of “universal priming” in the RACE PCR amplification. T his method, along with the techniques of suppression PCR and step-out PCR ensure high specificity in amplifying your target cDNA. T hese methods are described in detail below and in Appendix C.

The only requirement for SMART RACE cDNA amplification is that you know at least 23–28 nucleotides (nt) of sequence information in order to design gene-specific primers (GSPs) for the 5'- and 3'-RACE reactions. (Additional sequence information will facilitate analysis of your RACE products.) This limited requirement makes SMART RACE ideal for characterizing genes identified through diverse methods including cDNA subtraction, differential display, RNA fingerprinting, ESTs, library screening, and more.

SMART RACE cDNA amplification is a flexible tool—many researchers use this kit in place of conventional kits to amplify just the 5' or 3' end of a particular cDNA. Others perform both 5'- and 3'-RACE, and many then go on to clone full-length cDNAs using one of the two methods described in the latter part of this protocol. In many cases, researchers obtain full-length cDNAs without ever constructing or screening a cDNA library.

n/a = not available

* Compared to GenBank cDNA sequence

SMART? RACE cDNA Amplification Kit User Manual

Figure 2. Overview of the SMART? RACE procedure. Detailed flow charts of the SMART RACE mechanisms can be found in Appendices A & B. Note that with the cloned RACE fragments you can use a restriction site in an overlapping region to construct a full-length cDNA by sub-cloning. Alternatively, you can sequence the 5' end of the 5' product and the 3' end of the 3' product to obtain the sequences of the extreme ends of the transcript. Using this information, you can design 5' and 3' gene-specific primers to use in LD PCR with the 5'-RACE-Ready cDNA as template to generate the full-length cDNA. I. Introduction & Protocol Overview continued

SMART? RACE cDNA Amplification Kit User Manual I. Introduction & Protocol Overview continued

Overview of the SMART RACE cDNA amplification protocol

An overview of the SMART RACE cDNA amplification is presented in Figure 2. Detailed mechanisms of the RACE reactions are provided in Appendices A & B.

? Primer Design (Section V)

You must design gene-specific primers for the 5'- and/or 3'-RACE reactions (GSP1 and GSP2, respectively). As described, nested primers (NGSP1 and NGSP2) will facilitate analysis of your RACE products. T hey can also be used for nested RACE PCR if necessary. Primer design is discussed in detail in Section V; Figure 3 shows the relationship of primers and template used in SMART RACE reactions.

? First-strand cDNA synthesis (Section VII)

Since the 5' elongation benefits of SMART technology are only relevant for 5'-RACE, the SMART RACE Kit includes a protocol for the synthesis of two separate cDNA populations: 5'-RACE-Ready cDNA and 3'-RACE-Ready cDNA. The cDNA for 5'-RACE is synthesized using a modified lock-docking oligo(dT) primer and the SMART II A oligo as described above. The modified oligo(dT) primer, termed the 5'-RACE CDS Primer

A (5'-CDS), has two degenerate nucleotide positions at the 3' end. T hese

nucleotides position the primer at the start of the poly A+ tail and thus eliminate the 3' heterogeneity inherent with conventional oligo(dT) priming (Borson et al., 1994).

The 3'-RACE cDNA is synthesized using a traditional reverse transcription procedure, but with a special oligo(dT) primer. T his 3'-RACE CDS Primer

A (3'-CDS) primer includes the lock-docking nucleotide positions as in the

5'-CDS primer and also has a portion of the SMART sequence at its 5' end. By incorporating the SMART sequence into both the 5'- and 3'-RACE-Ready cDNA populations, you can prime both RACE PCR reactions using the Universal Primer A Mix (UPM), which recognizes the SMART sequence, in conjunction with distinct gene-specific primers.

? Positive Control RACE Experiment (Section VIII)

Prior to performing RACE with your template, we strongly recommend that you perform the positive control RACE experiment using the Control Human Placental T otal RNA provided in the kit.

? RACE PCR Reactions (Section IX)

After you generate RACE-Ready cDNAs, you will have enough material to perform 5'- and 3'-RACE with many different genes, simply by using different gene-specific primers. All PCR reactions in the SMART RACE protocol are optimized for use with the Advantage? 2 Polymerase Mix.

The Polymerase Mix is comprised of TITANIUM? T aq DNA Polymerase—a

SMART? RACE cDNA Amplification Kit User Manual

I. Introduction & Protocol Overview continued

nuclease-deficient N-terminal deletion of Taq DNA polymerase plus TaqStart? Antibody to provide automatic hot-start PCR (Kellogg et al., 1994)—and a minor amount of a proofreading polymerase. Advantage

2 technology enables you to perform long distance PCR (LD PCR) reac-

tions with confidence that your products will have high fidelity to the original sequences (Barnes, 1994; Cheng et al., 1994). As a result, you will be able to amplify longer templates than were possible in traditional RACE procedures.

? Characterization of RACE Products (Section X)

Before constructing your full-length cDNA, we strongly recommend that you confirm amplification of the desired target. You can character-ize your RACE products by one or more of the following: (1) comparing PCR products obtained using GSP1 and UPM to products generated with NGSP1 and UPM; (2) probing a Southern blot of your PCR products with an internal gene-specific probe (e.g., labeled NGSP1); and (3) cloning and sequencing your RACE products. In general, we recommend that you obtain at least some sequence information.

Careful characterization of your RACE products at this point can prevent confusion and wasted effort in your subsequent experiments, even when both RACE reactions produce single major products. This analysis is especially important if you have multiple RACE products or suspect that you are working with a member of a multigene family.

Note on “full-length” cDNAs: No method of cDNA synthesis can guarantee a full-length cDNA, particularly at the 5' end. Determining the true 5' end requires some combination of RNase protec-tion assays, primer extension assays, and cDNA or genomic sequence information. Many SMART RACE cDNAs include the complete 5' end of the cDNA; however, severe secondary structure may block the action of RT and/or T aq DNA polymerase in some instances. In our experience, SMART RACE products and full-length cDNAs compare favorably in this regard with cDNAs obtained by conventional RACE or from libraries. T o obtain the maximum possible amount of 5' sequence, we recommend that you sequence the 5' end of 5–10 separate clones of the 5'-RACE product.

SMART? RACE cDNA Amplification Kit User Manual II. List of Components

Store Control Human Placental T otal RNA and SMART II A Oligonucleotide at –70°C.

Store NucleoTrap? Gel Extraction Kit at room temperature.

Store all other reagents at –20°C.

First-strand cDNA Synthesis

? 7 μl SMART II? A Oligonucleotide (12 μM)

5'–AAGCAGTGGTATCAACGCAGAGTACGCGGG–3'

? 7 μl 3'-RACE CDS Primer A (3'-CDS; 12 μM)

5'–AAGCAGTGGTATCAACGCAGAGTAC(T)30V N–3'

(N = A, C, G, or T; V = A, G, or C)

? 7 μl 5'-RACE CDS Primer A (5'-CDS; 12 μM)

5'–(T)25V N–3'

(N = A, C, G, or T; V = A, G, or C)

? 200 μl5X First-Strand Buffer

250 mM Tris-HCl (pH 8.3)

375 mM KCl

30 mM MgCl2

? 200 μl Dithiothreitol (DTT; 20 mM)

? 1 ml Deionized H2O

5'- & 3'-RACE PCR

? 400 μl 10X universal Primer A Mix (UPM)

Long (0.4μM):

5'–CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT–3'

Short (2 μM):

5'–CTAATACGACTCACTATAGGGC–3'

? 50 μl Nested universal Primer A (NUP; 10 μM)

5'–AAGCAGTGGTATCAACGCAGAGT–3'

Control Reagents

? 5 μl Control Human Placental T otal RNA (1 μg/μl)

? 25 μl Control 5'-RACE TFR Primer (10 μM)

? 25 μl Control 3'-RACE TFR Primer (10 μM)

SMART? RACE cDNA Amplification Kit User Manual

II. List of Components continued

General Reagents

? 70 μl dNTP Mix (dATP, dCTP, dGTP, and dTTP, each at 10 mM)? 2 X 1 ml T ricine-EDTA Buffer

10 mM Tricine-KOH (pH 8.5)

1.0 mM EDTA

NucleoT rap? Gel Extraction Kit (Cat. No. 636053)

? 100 μl NucleoTrap Suspension

? 6 ml Buffer NT1

? 6 ml Buffer NT2

? 7 ml Buffer NT3 (concentrate)

5 ml Buffer NE

? User Manual (PT3169-1)

III. Additional Materials Required

The following reagents are required but not supplied:

? MML V Reverse T ranscriptase (Please see Addendum PT3980-4 for details on the choice of RT enzyme.)

? Advantage? 2 PCR Kit (Cat. Nos. 639206 & 639207)

? PCR reaction tubes

? Mineral oil (e.g., Sigma Cat. No. M-3516)

SMART? RACE cDNA Amplification Kit User Manual IV. General Considerations for SMART RACE

PLEASE READ ENTIRE PROTOCOL BEFORE STARTING

? The cycling parameters throughout this protocol were optimized with an authorized hot-lid thermal cycler, the Advantage 2 Polymerase Mix, and the reagents and TFR controls provided in the SMART RACE Kit.

The optimal cycling parameters may vary with different polymerase mixes, templates, gene-specific primers, and thermal cyclers. Prior to performing 5'- and 3'-RACE with your experimental sample, you should perform the positive control PCR experiment (Section VIII).

These reactions, which use cDNA generated from the Control Human Placental T otal RNA and the Control 5'- and 3'- RACE T FR Primers, will help determine if you need to alter the PCR program for your thermal cycler.

Please note that the efficiency of RACE PCR depends on the abundance of the mRNA of interest in your RNA sample. Additionally, different primers will have different optimal annealing/extension temperatures.

Refer to Section XI for suggestions on optimizing PCR conditions.? y ou must use some form of hot start in the 5'-RACE and 3'-RACE PCR reactions. The following protocols were optimized using the A dvantage

2 Polymerase Mix which contains T aqStart Antibody for automatic hot

start PCR (Kellogg et al., 1994). Hot start can also be performed using wax beads (Chou et al., 1992) or manually (D’Aquila et al., 1991).

? We recommend the T ricine-EDTA Buffer provided in the kit for resus-pending and diluting your DNA samples throughout this protocol. T ricine buffers maintain their pH at high temperature better than Tris-based buffers. T ris-based buffers can lead to low pH conditions that degrade DNA.

? Wear gloves throughout to protect your RNA samples from nucleases.? Resuspend pellets and mix reactions by gently pipetting the solution up and down or by tapping the bottom of the tube. T hen spin the tube briefly to bring all contents to the bottom.

? Perform all reactions on ice unless otherwise indicated.

? Add enzymes to reaction mixtures last.

? Use the recommended amounts of enzyme. T hese amounts have been carefully optimized for the SMART RACE amplification protocol and reagents.

? Ethidium bromide is a carcinogen. Use appropriate precautions in han-dling and disposing of this reagent. For more information, see Molecular Cloning: A Laboratory Manual by Sambrook & Russell (2001).

SMART? RACE cDNA Amplification Kit User Manual

V. Primer Design

A. Primer Sequence

Gene-Specific Primers (GSPs) should be:

? 23–28 nt

? 50–70% GC

? T m ≥65°C; best results are obtained if T m >70°C (enables the use of touchdown PCR)

The relationship of the primers used in the SMART RACE reactions to the template and resulting RACE products is shown in detail in Figure

3. For the complete SMART RACE protocol, you will need at least two

GSPs: an antisense primer for the 5'-RACE PCR and a sense primer for the 3'-RACE PCR. If you are doing only 5'- or 3'-RACE, you will only need one GSP. All primers should be 23–28 nt long; there is generally no advantage to using primers longer than 30 nt. The primers shown in Figure 3 will create overlapping 5'- and 3'-RACE products. If a suitable restriction site is located in the region of overlap, the fragments can subsequently be joined by restriction digestion and ligation to create the full-length cDNA. By designing primers that give a 100–200-bp overlap in the RACE products, you will also be able to use the prim-ers together as a positive control for the PCR reactions. However, it is not absolutely necessary to use primers that give overlapping frag-ments. In the case of large and/or rare cDNAs, it may be better to use primers that are closer to the ends of the cDNA and therefore do not create overlapping fragments. Additionally, the primers themselves can overlap (i.e., be complementary).

GSPs should have a GC content of 50–70% and a T m of at least 65°C;

whenever possible the T m should be greater than 70°C, as determined by nearest neighbor analysis (Freier et al., 1986; we use the Primer Pre-mier software to calculate T m’s). In our experience, longer primers with annealing temperatures above 70°C give more robust amplification in RACE, particularly from difficult samples. T m’s over 70°C allow you to use “touchdown PCR” (Section C below). Additionally, designing GSP1 and GSP2 so that they have similar T m’s will facilitate their use in the SMART RACE protocol. T m’s of GSP1 and GSP2 can be calculated or determined experimentally by performing PCR at different tempera-tures. Avoid using self-complementary primer sequences which can fold back and form intramolecular hydrogen bonds. Similarly, avoid primers that have complementarity to the primers in the Universal Primer Mix, particularly in their 3' ends. (See Section II for UPM primer sequences.)

Note: Do not incorporate restriction sites into the 5' ends of the 5' and 3' GSPs. In our experience, these extra sequences can lead to increased background.

SMART? RACE cDNA Amplification Kit User Manual

B. Location of Primer Sequences within Gene

We have had good success using the SMART RACE Kit to amplify 5' and 3' cDNA fragments that extend up to 6.5 kb from the GSP sites. Nevertheless, for optimum results we recommend choosing your prim-ers so that the 5'- and 3'-RACE products will be 2 kb or less. C. T ouchdown PCR

We have found that touchdown PCR (Don et al., 1991; Roux, 1995) significantly improves the specificity of SMART RACE amplification. Touchdown PCR uses an annealing temperature during the initial PCR cycles that is higher than the T m of the Universal Primer. If the T m of your GSP is >70°C, only gene-specific synthesis occurs during these cycles, allowing a critical amount of gene-specific product to accumu-late. T he annealing temperature is then reduced to a level compatible with the UPM, permitting efficient, exponential amplification of the gene-specific template. (See Appendices A–C for more details.)

As noted above, we recommend using primers with T m ’s >70°C to allow you to use the touchdown cycling programs in the protocol. (Non-touchdown cycling programs are also included for use with primers with T m ’s <70°C.)

D. Nested Primers

We recommend that you do not use nested PCR in your initial experiments. The UPM Primer and a GSP will usually generate a good RACE product with a low level of nonspecific background. However, Southern blotting with nested GSPs (NGSP1 and

V . Primer Design continued

Figure 3. T he relationship of gene-specific primers to the cDNA template. T his diagram shows a generalized first-strand cDNA template. T his RNA/DNA hybrid does not precisely represent either the 5'-RACE-Ready or 3'-RACE-Ready cDNAs. For a detailed look at those structures, see Appendices A & B. Note that the gene-specific primers designed here produce overlapping RACE products. This overlap permits the use of the primers together in a control PCR reac-tion. Additionally, if a suitable restriction site is located within this region, it will be possible to construct the full-length cDNA by subcloning.

SMART? RACE cDNA Amplification Kit User Manual

V. Primer Design continued

NGSP2) as probes is useful for characterizing your RACE prod-ucts. Furthermore, nested PCR may be necessary in some cases where the level of background or nonspecific amplification in the 5'- or 3'-RACE reaction is too high with a single GSP. In nested PCR,

a primary amplification is performed with the outer primers and, if a

smear is produced, an aliquot of the primary PCR product is reampli-fied using the inner primers. The SMART RACE protocols include op-tional steps indicating where nested primers can be used. T he Nested Universal Primer A (provided with the kit) can be used for both 5'- and 3'-RACE.

Nested gene specific primers should be designed according to the guidelines discussed above. If possible, nested primers should not overlap with the outer gene-specific primers; if they must overlap due to limited sequence information, the 3' end of the inner primer should have as much unique sequence as possible.

SMART? RACE cDNA Amplification Kit User Manual VI. Preparation & Handling of T otal and Poly A+ RNA

A. General Precautions

The integrity and purity of your total or poly A+ RNA starting material is an important element in high-quality cDNA synthesis. The follow-ing precautions will help you avoid contamination and degradation of your RNA:

? Wear gloves.

? Use freshly deionized (e.g., MilliQ-grade) H2O directly, without

treatment with DEPC (diethyl pyrocarbonate).

? Rinse all glassware with 0.5 N NaOH, followed by deionized H2O.

Then bake the glassware at 160–180°C for 4–9 hr.

? Use only single-use plastic pipettes and pipette tips.

B. RNA Isolation

Clontech offers several kits for the purification of total RNA such as the NucleoBond? RNA/DNA Mini Kit (Cat. No. 635945). Many procedures are available for the isolation of poly A+ RNA (Farrell, 1993; Sambrook et al., 1989).

C. RNA Analysis

We recommend that you examine your RNA by electrophoresing a sample on a denaturing formaldehyde agarose/EtBr gel. Mammalian total RNA typically exhibits two bright bands at 4.5 and 1.9 kb; these bands correspond to 28S and 18S ribosomal RNA, respectively. The ratio of intensities of these bands should be about 1–2:1. Poly A+ RNA samples from mammalian cells should produce smears from 0.5–12 kb with much weaker ribosomal RNA bands. Size distribution may be smaller with nonmammalian tissue sources.

SMART? RACE cDNA Amplification Kit User Manual

V II. First-Strand cDNA Synthesis

The two 10-μl reactions described below convert 50 ng–1 μg of total or poly A+ RNA into RACE-Ready first-strand cDNA.

We recommend that you use poly A+ RNA whenever possible. However, if you have less than 50 μg of total RNA we do not recommend purification of poly A+ RNA because the final yield will be too small to effectively analyze the RNA quantity and quality. For optimal results, use 1 μg of poly A+ RNA or 1 μg of total RNA in the reactions below.

we strongly recommend that you perform a positive control cDNA syn-thesis using the included Human Placental T otal RNA in addition to your experimental reactions.T his cDNA will be used in the positive control RACE reactions in Section VIII.

1. Combine the following in separate microcentrifuge tubes:

For preparation of For preparation of

5'-RACE-Ready cDNA 3'-RACE-Ready cDNA

1–3 μl RNA sample* 1–3 μl RNA sample*

1 μl 5'-CDS primer A 1 μl 3'-CDS primer A

1 μl SMART II A oligo

* For the control synthesis, use 1 μl of Control Human Placental Total RNA (1

μg/μl).

2. Add sterile H2O to a final volume of 5 μl for each reaction.

3. Mix contents and spin the tubes briefly in a microcentrifuge.

4. Incubate the tubes at 70°C for 2 min.

5. Cool the tubes on ice for 2 min.

6. Spin the tubes briefly to collect the contents at the bottom.

7. Add the following to each reaction tube (already containing

5 μl):

2 μl 5X First-Strand Buffer

1 μl DTT (20 mM)

1 μl dNTP Mix (10 mM)

1 μl MMLV Reverse T ranscriptase*

10 μl T otal volume

* Please see Addendum PT3980-4 for details on the choice of RT enzyme.

8. Mix the contents of the tubes by gently pipetting.

9. Spin the tubes briefly to collect the contents at the bottom.

10. Incubate the tubes at 42°C for 1.5 hr in an air incubator or a hot-lid

SMART? RACE cDNA Amplification Kit User Manual V II. First-Strand cDNA Synthesis continued

thermal cycler.

Note:Using a water bath or thermal cycler for this incubation may reduce the

volume of the reaction mixture (due to evaporation), and therefore reduce the ef-

ficiency of first-strand synthesis.

11. Dilute the first-strand reaction product with T ricine-EDTA Buffer:

? Add 20 μl if you started with <200 ng of total RNA.

? Add 100 μl if you started with >200 ng of total RNA.

? Add 250 μl if you started with poly A+ RNA.

12. Heat tubes at 72°C for 7 min.

13. Samples can be stored at –20°C for up to three months.

At this point, you have 3'- and 5'-RACE-Ready cDNA samples. The RACE reactions in Section IX use only a fraction of this material for each RNA of interest. There is sufficient single-stranded cDNA for PCR amplification of multiple genes.

If you intend to use LD PCR to construct your full-length cDNA after complet-ing 5'- and 3'-RACE, be sure to set aside an aliquot of the 5'-RACE-Ready cDNA to use as a template in the PCR reaction.

SMART? RACE cDNA Amplification Kit User Manual

V III. Positive Control PCR Experiment

Prior to performing 5'- and 3'-RACE reactions with your cDNA, we strongly recommend that you perform the following positive control RACE PCR ex-periment using the RACE-Ready cDNAs generated from the Control Human Placental T otal RNA. T hese reactions will amplify the ends of the transferrin receptor (TFR) cDNA. This procedure can save you considerable time by ensuring that the SMART RACE protocol works with your thermal cycler. If problems arise later in the protocol, the results of this experiment will help you determine immediately if the problem is with your RACE PCR (e.g., different thermal cycler) or with your cDNA.

We recommend that you first perform SMART RACE PCR reactions using the Advantage?2 Polymerase Mix (Cat. Nos. 639206 & 639207). If your cDNA of interest has high GC content you can use the Advantage GC 2 Polymerase Mix (Cat. No. 639114) or PCR Kit (Cat. Nos. 639119 & 639120) for subsequent analysis. For applications in which the highest fidelity prod-uct is desired, the Advantage HF 2 PCR Kit (Cat. Nos. 639123 & 639124) can amplify templates up to 3.5 kb. For more information, see Section XI (Troubleshooting Guide).

1. Prepare enough Master Mix for all PCR reactions and 1 extra reac-

tion to ensure sufficient volume. For each 50-μl PCR reaction, mix

the following reagents:

34.5 μl PCR-Grade Water

5 μl 10X Advantage 2 PCR Buffer

1 μl dNTP Mix (10 mM; in SMART RACE or Advantage 2

PCR Kit)

1 μl 50X Advantage

2 Polymerase Mix

41.5 μl T otal volume

2. Mix well by vortexing (without introducing bubbles), then briefly

spin the tube in a microcentrifuge.

3. Prepare PCR reactions as shown in Table II. Add the components

to PCR tubes in the order shown and mix gently.

SMART? RACE cDNA Amplification Kit User Manual V III. Positive Control PCR Experiment continued

4. Overlay the contents of each tube with 2 drops of mineral oil and

place caps firmly on each tube.

Note: Mineral oil is not necessary if you are using a hot-lid thermal cycler.

5. Commence thermal cycling using the following program for

touchdown PCR.

? 5 cycles:

94°C 30 sec

72°C 3 min

? 5 cycles:

94°C 30 sec

70°C 30 sec

72°C 3 min

? 27 cycles:

94°C 30 sec

68°C 30 sec

72°C 3 min

6. Analyze 5 μl of each sample on a 1.2 % agarose/EtBr gel. Store the

remaining 45 μl of each reaction at –20°C until you are sure the

control experiment has worked.

SMART? RACE cDNA Amplification Kit User Manual

V III. Positive Control PCR Experiment continued

Expected results (see lanes 2 and 5 of the gels in Figure 4): The 5'-RACE control reaction should produce a 2.6-kb band. T he 3'-RACE control reaction should produce a 2.9-kb band. If you do not observe these bands, return the tube(s) to your PCR machine and try cycling the remaining portion of the reaction for 5 additional cycles. If you still do not see the desired product, consult Section XI for troubleshooting. Before you attempt 5'- and 3'-RACE with your primers and experimental cDNA, we recommend that the positive control reactions produce single strong bands of the correct size in 42 or fewer total cycles (5 cycles annealing at 72°C + 5 cycles at 70°C + 32 cycles at 68°C).

Figure 4. 5'- and 3'-RACE sample results. At Clontech, we have used the SMART RACE Kit to amplify 5'- and 3'-RACE fragments of many different genes starting with poly A+and total RNA. T his gel shows several representative 5'- and 3'-RACE amplifications starting with total RNA. Lanes 1 & 4: interferon-γ receptor. Lanes 2 & 5: transferrin receptor. Lanes 3 & 6: HPRT. T he control PCR reactions described for transferrin receptor amplification should produce the RACE products in lanes 2 & 5. The 5' product will be 2.6 kb; the 3' product will be 2.9 kb. As seen here, a minor 0.6-kb product will occasionally be generated in transferrin receptor 3'-RACE.

M 1 2 3 4 5 6

5'-RACE 3'-RACE kb

3.0

2.0

1.6

0.5

1.0